DNASU Plasmid Repository • 480.965.5697 | Email

TCEA1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TCEA1
Gene Name:  transcription elongation factor A (SII), 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH131150.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00001723

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 906nts        
Open reading frame : 1 to 906
Reference Sequence Alignment

ATGGAGGACGAAGTGGTCCGCTTTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAAC
GCGGCTGGAGCATTGGATTTGCTAAAGGAGCTTAAGAATATTCCTATGACCCTGGAATTA
CTGCAGTCCACAAGAATCGGAATGTCAGTTAATGCTATTCGCAAGCAGAGTACAGATGAG
GAAGTTACATCTTTGGCAAAGTCTCTCATCAAATCCTGGAAAAAATTATTAGATGGGCCA
TCAACTGAGAAAGACCTTGACGAAAAGAAGAAAGAACCTGCAATTACATCGCAGAACAGC
CCTGAGGCAAGAGAAGAAAGTACTTCCAGCGGCAATGTAAGCAACAGAAAGGATGAGACA
AATGCTCGAGATACTTATGTTTCATCCTTTCCTCGGGCACCAAGCACTTCTGATTCTGTG
CGGTTGAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGGGATGACTACATTGCA
ATTGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAAGAAGCTATATATCAAGAAATA
AGGAATACAGACATGAAATACAAAAATAGAGTACGAAGTAGGATATCAAATCTTAAAGAT
GCAAAAAATCCAAATTTAAGAAAAAATGTCCTCTGTGGGAATATTCCTCCTGACTTATTT
GCTAGAATGACAGCAGAGGAAATGGCTAGTGATGAGCTGAAAGAGATGCGGAAAAACTTG
ACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACTGGTGGGACCCAGACTGACTTG
TTCACATGTGGCAAATGTAAAAAGAAGAATTGCACTTACACACAGGTACAAACCCGTAGT
GCTGATGAACCAATGACAACATTTGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTC
TGTGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1010
Start on reference sequence 105
Mutations:
None
Discrepancy:
g621a
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TCEA1
Symbol Nomenclature : TCEA1
SYNONYM : GTF2S; SII; TCEA; TF2S; TFIIS
Designation : transcription elongation factor A protein 1|transcription elongation factor S-II protein 1|transcription elongation factor TFIIS.o
Full Nomenclature : transcription elongation factor A (SII), 1
GENEID : 6917
GI : 60829874
GenBank Accession : AY893861
HGNC : 11612
MIM : 601425
Vega : OTTHUMG00000164262
Target GenBank: NM_006756

 

Reference Sequence Alignment

  

HsCD00001723      ATGGAGGACGAAGTGGTCCGCTTTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAAC
NM_006756.3       ATGGAGGACGAAGTGGTCCGCTTTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAAC
NM_201437.2       ATGGAGGACGAAGTGGTCCGCTTTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAAC
                  ************************************************************

HsCD00001723      GCGGCTGGAGCATTGGATTTGCTAAAGGAGCTTAAGAATATTCCTATGACCCTGGAATTA
NM_006756.3       GCGGCTGGAGCATTGGATTTGCTAAAGGAGCTTAAGAATATTCCTATGACCCTGGAATTA
NM_201437.2       GCG---------------------------------------------------------
                  ***                                                         

HsCD00001723      CTGCAGTCCACAAGAATCGGAATGTCAGTTAATGCTATTCGCAAGCAGAGTACAGATGAG
NM_006756.3       CTGCAGTCCACAAGAATCGGAATGTCAGTTAATGCTATTCGCAAGCAGAGTACAGATGAG
NM_201437.2       ------TCCACAAGAATCGGAATGTCAGTTAATGCTATTCGCAAGCAGAGTACAGATGAG
                        ******************************************************

HsCD00001723      GAAGTTACATCTTTGGCAAAGTCTCTCATCAAATCCTGGAAAAAATTATTAGATGGGCCA
NM_006756.3       GAAGTTACATCTTTGGCAAAGTCTCTCATCAAATCCTGGAAAAAATTATTAGATGGGCCA
NM_201437.2       GAAGTTACATCTTTGGCAAAGTCTCTCATCAAATCCTGGAAAAAATTATTAGATGGGCCA
                  ************************************************************

HsCD00001723      TCAACTGAGAAAGACCTTGACGAAAAGAAGAAAGAACCTGCAATTACATCGCAGAACAGC
NM_006756.3       TCAACTGAGAAAGACCTTGACGAAAAGAAGAAAGAACCTGCAATTACATCGCAGAACAGC
NM_201437.2       TCAACTGAGAAAGACCTTGACGAAAAGAAGAAAGAACCTGCAATTACATCGCAGAACAGC
                  ************************************************************

HsCD00001723      CCTGAGGCAAGAGAAGAAAGTACTTCCAGCGGCAATGTAAGCAACAGAAAGGATGAGACA
NM_006756.3       CCTGAGGCAAGAGAAGAAAGTACTTCCAGCGGCAATGTAAGCAACAGAAAGGATGAGACA
NM_201437.2       CCTGAGGCAAGAGAAGAAAGTACTTCCAGCGGCAATGTAAGCAACAGAAAGGATGAGACA
                  ************************************************************

HsCD00001723      AATGCTCGAGATACTTATGTTTCATCCTTTCCTCGGGCACCAAGCACTTCTGATTCTGTG
NM_006756.3       AATGCTCGAGATACTTATGTTTCATCCTTTCCTCGGGCACCAAGCACTTCTGATTCTGTG
NM_201437.2       AATGCTCGAGATACTTATGTTTCATCCTTTCCTCGGGCACCAAGCACTTCTGATTCTGTG
                  ************************************************************

HsCD00001723      CGGTTGAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGGGATGACTACATTGCA
NM_006756.3       CGGTTGAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGGGATGACTACATTGCA
NM_201437.2       CGGTTGAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGGGATGACTACATTGCA
                  ************************************************************

HsCD00001723      ATTGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAAGAAGCTATATATCAAGAAATA
NM_006756.3       ATTGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAAGAAGCTATATATCAAGAAATA
NM_201437.2       ATTGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAAGAAGCTATATATCAAGAAATA
                  ************************************************************

HsCD00001723      AGGAATACAGACATGAAATACAAAAATAGAGTACGAAGTAGGATATCAAATCTTAAAGAT
NM_006756.3       AGGAATACAGACATGAAATACAAAAATAGAGTACGAAGTAGGATATCAAATCTTAAAGAT
NM_201437.2       AGGAATACAGACATGAAATACAAAAATAGAGTACGAAGTAGGATATCAAATCTTAAAGAT
                  ************************************************************

HsCD00001723      GCAAAAAATCCAAATTTAAGAAAAAATGTCCTCTGTGGGAATATTCCTCCTGACTTATTT
NM_006756.3       GCAAAAAATCCAAATTTAAGGAAAAATGTCCTCTGTGGGAATATTCCTCCTGACTTATTT
NM_201437.2       GCAAAAAATCCAAATTTAAGGAAAAATGTCCTCTGTGGGAATATTCCTCCTGACTTATTT
                  ********************.***************************************

HsCD00001723      GCTAGAATGACAGCAGAGGAAATGGCTAGTGATGAGCTGAAAGAGATGCGGAAAAACTTG
NM_006756.3       GCTAGAATGACAGCAGAGGAAATGGCTAGTGATGAGCTGAAAGAGATGCGGAAAAACTTG
NM_201437.2       GCTAGAATGACAGCAGAGGAAATGGCTAGTGATGAGCTGAAAGAGATGCGGAAAAACTTG
                  ************************************************************

HsCD00001723      ACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACTGGTGGGACCCAGACTGACTTG
NM_006756.3       ACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACTGGTGGGACCCAGACTGACTTG
NM_201437.2       ACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACTGGTGGGACCCAGACTGACTTG
                  ************************************************************

HsCD00001723      TTCACATGTGGCAAATGTAAAAAGAAGAATTGCACTTACACACAGGTACAAACCCGTAGT
NM_006756.3       TTCACATGTGGCAAATGTAAAAAGAAGAATTGCACTTACACACAGGTACAAACCCGTAGT
NM_201437.2       TTCACATGTGGCAAATGTAAAAAGAAGAATTGCACTTACACACAGGTACAAACCCGTAGT
                  ************************************************************

HsCD00001723      GCTGATGAACCAATGACAACATTTGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTC
NM_006756.3       GCTGATGAACCAATGACAACATTTGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTC
NM_201437.2       GCTGATGAACCAATGACAACATTTGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTC
                  ************************************************************

HsCD00001723      TGTGAC
NM_006756.3       TGTTGA
NM_201437.2       TGTTGA
                  *** ..

Pathways

Reactome : Disease
Reactome : DNA Repair
Reactome : Dual incision reaction in TC-NER
Reactome : Elongation arrest and recovery
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Formation of transcription-coupled NER (TC-NER) repair complex
Reactome : Gene Expression
Reactome : HIV elongation arrest and recovery
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : Late Phase of HIV Life Cycle
Reactome : Nucleotide Excision Repair
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcription-coupled NER (TC-NER)

Clone

Cloning Information : 131150
HIP Master Clone ID : 107307
Original Clone ID : FLH131150.01L

Organism


TAX_ID : 9606
Species Specific ID: 6917

Genome

Chromosome : 8
Map Location : 8q11.2
Ensembl : ENSG00000187735

Reagents

Labome : TCEA1-antibody