DNASU Plasmid Repository • 480.965.5697 | Email

POMC (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  POMC
Gene Name:  proopiomelanocortin
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH130898.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00001726

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 804nts         Open reading frame : 1 to 804
Reference Sequence Alignment

ATGCCGAGATCGTGCTGCAGCCGCTCGGGGGCCCTGTTGCTGGCCTTGCTGCTTCAGGCC
TCCATGGAAGTGCGTGGCTGGTGCCTGGAGAGCAGCCAGTGTCAGGACCTCACCACGGAA
AGCAACCTGCTGGAGTGCATCCGGGCCTGCAAGCCCGACCTCTCGGCCGAGACTCCCATG
TTCCCGGGAAATGGCGACGAGCAGCCTCTGACCGAGAACCCCCGGAAGTACGTCATGGGC
CACTTCCGCTGGGACCGATTCGGCCGCCGCAACAGCAGCAGCAGCGGCAGCAGCGGCGCA
GGGCAGAAGCGCGAGGACGTCTCAGCGGGCGAAGACTGCGGCCCGCTGCCTGAGGGCGGC
CCCGAGCCCCGCAGCGATGGTGCCAAGCCGGGCCCGCGCGAGGGCAAGCGCTCCTACTCC
ATGGAGCACTTCCGCTGGGGCAAGCCGGTGGGCAAGAAGCGGCGCCCAGTGAAGGTGTAC
CCTAACGGCGCCGATGACGAGTCGGCCGAGGCCTTCCCCCTGGAGTTCAAGAGGGAGCTG
ACTGGCCAGCGACTCCGGGAGGGAGATGGCCCCGACGGCCCTGCCGATGACGGCGCAGGG
GCCCAGGCCGACCTGGAGCACAGCCTGCTGGTGGCGGCCGAGAAGAAGGACGAGGGCCCC
TACAGGATGGAGCACTTCCGCTGGGGCAGCCCGCCCAAGGACAAGCGCTACGGCGGTTTC
ATGACCTCCGAGAAGAGCCAGACGCCCCTGGTGACGCTGTTCAAAAACGCCATCATCAAG
AACGCCTACAAGAAGGGCGAGGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 910
Start on reference sequence 107
Mutations:
None
Discrepancy:
g495t,E165D
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : POMC
Symbol Nomenclature : POMC
SYNONYM : ACTH; CLIP; LPH; MSH; NPP; POC
Designation : adrenocorticotropic hormone|adrenocorticotropin|alpha-MSH|alpha-melanocyte-stimulating hormone|beta-LPH|beta-MSH|beta-endorphin|beta-melanocyte-stimulating hormone|corticotropin-like intermediary peptide|corticotropin-lipotropin|gamma-LPH|gamma-MSH|lipotropin beta|lipotropin gamma|melanotropin alpha|melanotropin beta|melanotropin gamma|met-enkephalin|opiomelanocortin prepropeptide|pro-ACTH-endorphin|pro-opiomelanocortin|proopiomelanocortin preproprotein
Full Nomenclature : proopiomelanocortin
GENEID : 5443
GI : 60829893
GenBank Accession : AY893863
HGNC : 9201
MIM : 176830
Vega : OTTHUMG00000094764
Target GenBank: NM_000939

 

Reference Sequence Alignment

  

HsCD00001726        ATGCCGAGATCGTGCTGCAGCCGCTCGGGGGCCCTGTTGCTGGCCTTGCTGCTTCAGGCC
NM_000939.2         ATGCCGAGATCGTGCTGCAGCCGCTCGGGGGCCCTGTTGCTGGCCTTGCTGCTTCAGGCC
NM_001035256.1      ATGCCGAGATCGTGCTGCAGCCGCTCGGGGGCCCTGTTGCTGGCCTTGCTGCTTCAGGCC
                    ************************************************************

HsCD00001726        TCCATGGAAGTGCGTGGCTGGTGCCTGGAGAGCAGCCAGTGTCAGGACCTCACCACGGAA
NM_000939.2         TCCATGGAAGTGCGTGGCTGGTGCCTGGAGAGCAGCCAGTGTCAGGACCTCACCACGGAA
NM_001035256.1      TCCATGGAAGTGCGTGGCTGGTGCCTGGAGAGCAGCCAGTGTCAGGACCTCACCACGGAA
                    ************************************************************

HsCD00001726        AGCAACCTGCTGGAGTGCATCCGGGCCTGCAAGCCCGACCTCTCGGCCGAGACTCCCATG
NM_000939.2         AGCAACCTGCTGGAGTGCATCCGGGCCTGCAAGCCCGACCTCTCGGCCGAGACTCCCATG
NM_001035256.1      AGCAACCTGCTGGAGTGCATCCGGGCCTGCAAGCCCGACCTCTCGGCCGAGACTCCCATG
                    ************************************************************

HsCD00001726        TTCCCGGGAAATGGCGACGAGCAGCCTCTGACCGAGAACCCCCGGAAGTACGTCATGGGC
NM_000939.2         TTCCCGGGAAATGGCGACGAGCAGCCTCTGACCGAGAACCCCCGGAAGTACGTCATGGGC
NM_001035256.1      TTCCCGGGAAATGGCGACGAGCAGCCTCTGACCGAGAACCCCCGGAAGTACGTCATGGGC
                    ************************************************************

HsCD00001726        CACTTCCGCTGGGACCGATTCGGCCGCCGCAACAGCAGCAGCAGCGGCAGCAGCGGCGCA
NM_000939.2         CACTTCCGCTGGGACCGATTCGGCCGCCGCAACAGCAGCAGCAGCGGCAGCAGCGGCGCA
NM_001035256.1      CACTTCCGCTGGGACCGATTCGGCCGCCGCAACAGCAGCAGCAGCGGCAGCAGCGGCGCA
                    ************************************************************

HsCD00001726        GGGCAGAAGCGCGAGGACGTCTCAGCGGGCGAAGACTGCGGCCCGCTGCCTGAGGGCGGC
NM_000939.2         GGGCAGAAGCGCGAGGACGTCTCAGCGGGCGAAGACTGCGGCCCGCTGCCTGAGGGCGGC
NM_001035256.1      GGGCAGAAGCGCGAGGACGTCTCAGCGGGCGAAGACTGCGGCCCGCTGCCTGAGGGCGGC
                    ************************************************************

HsCD00001726        CCCGAGCCCCGCAGCGATGGTGCCAAGCCGGGCCCGCGCGAGGGCAAGCGCTCCTACTCC
NM_000939.2         CCCGAGCCCCGCAGCGATGGTGCCAAGCCGGGCCCGCGCGAGGGCAAGCGCTCCTACTCC
NM_001035256.1      CCCGAGCCCCGCAGCGATGGTGCCAAGCCGGGCCCGCGCGAGGGCAAGCGCTCCTACTCC
                    ************************************************************

HsCD00001726        ATGGAGCACTTCCGCTGGGGCAAGCCGGTGGGCAAGAAGCGGCGCCCAGTGAAGGTGTAC
NM_000939.2         ATGGAGCACTTCCGCTGGGGCAAGCCGGTGGGCAAGAAGCGGCGCCCAGTGAAGGTGTAC
NM_001035256.1      ATGGAGCACTTCCGCTGGGGCAAGCCGGTGGGCAAGAAGCGGCGCCCAGTGAAGGTGTAC
                    ************************************************************

HsCD00001726        CCTAACGGCGCCGATGACGAGTCGGCCGAGGCCTTCCCCCTGGAGTTCAAGAGGGAGCTG
NM_000939.2         CCTAACGGCGCCGAGGACGAGTCGGCCGAGGCCTTCCCCCTGGAGTTCAAGAGGGAGCTG
NM_001035256.1      CCTAACGGCGCCGAGGACGAGTCGGCCGAGGCCTTCCCCCTGGAGTTCAAGAGGGAGCTG
                    ************** *********************************************

HsCD00001726        ACTGGCCAGCGACTCCGGGAGGGAGATGGCCCCGACGGCCCTGCCGATGACGGCGCAGGG
NM_000939.2         ACTGGCCAGCGACTCCGGGAGGGAGATGGCCCCGACGGCCCTGCCGATGACGGCGCAGGG
NM_001035256.1      ACTGGCCAGCGACTCCGGGAGGGAGATGGCCCCGACGGCCCTGCCGATGACGGCGCAGGG
                    ************************************************************

HsCD00001726        GCCCAGGCCGACCTGGAGCACAGCCTGCTGGTGGCGGCCGAGAAGAAGGACGAGGGCCCC
NM_000939.2         GCCCAGGCCGACCTGGAGCACAGCCTGCTGGTGGCGGCCGAGAAGAAGGACGAGGGCCCC
NM_001035256.1      GCCCAGGCCGACCTGGAGCACAGCCTGCTGGTGGCGGCCGAGAAGAAGGACGAGGGCCCC
                    ************************************************************

HsCD00001726        TACAGGATGGAGCACTTCCGCTGGGGCAGCCCGCCCAAGGACAAGCGCTACGGCGGTTTC
NM_000939.2         TACAGGATGGAGCACTTCCGCTGGGGCAGCCCGCCCAAGGACAAGCGCTACGGCGGTTTC
NM_001035256.1      TACAGGATGGAGCACTTCCGCTGGGGCAGCCCGCCCAAGGACAAGCGCTACGGCGGTTTC
                    ************************************************************

HsCD00001726        ATGACCTCCGAGAAGAGCCAGACGCCCCTGGTGACGCTGTTCAAAAACGCCATCATCAAG
NM_000939.2         ATGACCTCCGAGAAGAGCCAGACGCCCCTGGTGACGCTGTTCAAAAACGCCATCATCAAG
NM_001035256.1      ATGACCTCCGAGAAGAGCCAGACGCCCCTGGTGACGCTGTTCAAAAACGCCATCATCAAG
                    ************************************************************

HsCD00001726        AACGCCTACAAGAAGGGCGAGGAC
NM_000939.2         AACGCCTACAAGAAGGGCGAGTGA
NM_001035256.1      AACGCCTACAAGAAGGGCGAGTGA
                    ********************* ..

Pathways

NCI : Glucocorticoid receptor regulatory network
NCI : Syndecan-3-mediated signaling events
Panther : Cortocotropin releasing factor receptor signaling pathway
Panther : Opioid proopiomelanocortin pathway
Reactome : Androgen biosynthesis
Reactome : Biological oxidations
Reactome : Class A/1 (Rhodopsin-like receptors)
Reactome : Cytochrome P450 - arranged by substrate type
Reactome : Endogenous sterols
Reactome : G alpha (i) signalling events
Reactome : G alpha (s) signalling events
Reactome : G-protein activation
Reactome : GPCR downstream signaling
Reactome : GPCR ligand binding
Reactome : Glucocorticoid biosynthesis
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Metabolism of proteins
Reactome : Metabolism of steroid hormones and vitamin D
Reactome : Opioid Signalling
Reactome : Peptide hormone biosynthesis
Reactome : Peptide hormone metabolism
Reactome : Peptide ligand-binding receptors
Reactome : Phase 1 - Functionalization of compounds
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Steroid hormones

Protein

UniProt : Q53T23
UniProt : Q6FHC8
UniProt : P01189
HPRD : 01462

Clone

Cloning Information : 130898
HIP Master Clone ID : 107055
Original Clone ID : FLH130898.01L

Organism


TAX_ID : 9606
Species Specific ID: 5443

Genome

Chromosome : 2
Map Location : 2p23.3
Ensembl : ENSG00000115138

Reagents

Labome : ACTH-antibody