DNASU Plasmid Repository • 480.965.5697 | Email

HDAC1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HDAC1
Gene Name:  histone deacetylase 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH014187.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001873

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1449nts         Open reading frame : 1 to 1449
Reference Sequence Alignment

ATGGCGCAGACGCAGGGCACCCGGAGGAAAGTCTGTTACTACTACGACGGGGATGTTGGA
AATTACTATTATGGACAAGGCCACCCAATGAAGCCTCACCGAATCCGCATGACTCATAAT
TTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCCAAT
GCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATCCGT
CCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGT
CCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGT
GCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCAC
CATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATC
CTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACATTGACATTGATATTCACCATGGT
GACGGCGTGGAAGAGGCCTTCTACACCACGGACCGGGTCATGACTGTGTCCTTTCATAAG
TATGGAGAGTACTTCCCAGGAACTGGGGACCTACGGGATATCGGGGCTGGCAAAGGCAAG
TATTATGCTGTTAACTACCCGCTCCGAGACGGGATTGATGACGAGTCCTATGAGGCCATT
TTCAAGCCGGTCATGTCCAAAGTAATGGAGATGTTCCAGCCTAGTGCGGTGGTCTTACAG
TGTGGCTCAGACTCCCTATCTGGGGATCGGTTAGGTTGCTTCAATCTAACTATCAAAGGA
CACGCCAAGTGTGTGGAATTTGTCAAGAGCTTTAACCTGCCTATGCTGATGCTGGGAGGC
GGTGGTTACACCATTCGTAACGTTGCCCGGTGCTGGACATATGAGACAGCTGTGGCCCTG
GATACGGAGATCCCTAATGAGCTTCCATACAATGACTACTTTGAATACTTTGGACCAGAT
TTCAAGCTCCACATCAGTCCTTCCAATATGACTAACCAGAACACGAATGAGTACCTGGAG
AAGATCAAACAGCGACTGTTTGAGAACCTTAGAATGCTGCCGCACGCACCTGGGGTCCAA
ATGCAGGCGATTCCTGAGGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGACGAC
CCTGACAAGCGCATCTCGATCTGCTCCTCTGACAAACGAATTGCCTGTGAGGAAGAGTTC
TCCGATTCTGAAGAGGAGGGAGAGGGGGGCCGCAAGAACTCTTCCAACTTCAAAAAAGCC
AAGAGAGTCAAAACAGAGGATGAAAAAGAGAAAGACCCAGAGGAGAAGAAAGAAGTCACC
GAAGAGGAGAAAACCAAGGAGGAGAAGCCAGAAGCCAAAGGGGTCAAGGAGGAGGTCAAG
TTGGCCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1492
Start on reference sequence 44
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HDAC1
Symbol Nomenclature : HDAC1
SYNONYM : GON-10; HD1; RPD3; RPD3L1
Designation : reduced potassium dependency, yeast homolog-like 1
Full Nomenclature : histone deacetylase 1
GENEID : 3065
Locus Tag : RP4-811H24.2
GI : 61369535
GenBank Accession : AY891420
HGNC : 4852
MIM : 601241
Vega : OTTHUMG00000007529
Target GenBank: BC000301

 

Reference Sequence Alignment

  

HsCD00001873      ---ATGGCGCAGACGCAGGGCACCCGGAGGAAAGTCTGTTACTACTACGACGGGGATGTT
NM_001527.3       ATGGCGTACAGTCAAGGAGGCGGCAAAAAAAAAGTCTGCTACTACTACGACGGTGATATT
NM_004964.2       ---ATGGCGCAGACGCAGGGCACCCGGAGGAAAGTCTGTTACTACTACGACGGGGATGTT
                     . * . .. ... ..***. *...*..******** ************** ***.**

HsCD00001873      GGAAATTACTATTATGGACAAGGCCACCCAATGAAGCCTCACCGAATCCGCATGACTCAT
NM_001527.3       GGAAATTATTATTATGGACAGGGTCATCCCATGAAGCCTCATAGAATCCGCATGACCCAT
NM_004964.2       GGAAATTACTATTATGGACAAGGCCACCCAATGAAGCCTCACCGAATCCGCATGACTCAT
                  ******** ***********.** ** **.*********** .************* ***

HsCD00001873      AATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCC
NM_001527.3       AACTTGCTGTTAAATTATGGCTTATACAGAAAAATGGAAATATATAGGCCCCATAAAGCC
NM_004964.2       AATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCC
                  ** ****** *.** *****  *.***.*************.***.* ** ** ******

HsCD00001873      AATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATC
NM_001527.3       ACTGCCGAAGAAATGACAAAATATCACAGTGATGAGTATATCAAATTTCTACGGTCAATA
NM_004964.2       AATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATC
                  *.*** **.**.*****.**.** ***** ***** ** ** *****  *.** **.**.

HsCD00001873      CGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGAC
NM_001527.3       AGACCAGATAACATGTCTGAGTATAGTAAGCAGATGCAGAGATTTAATGTTGGAGAAGAT
NM_004964.2       CGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGAC
                  .*:************** ***** ** ***************** ** *****:**.** 

HsCD00001873      TGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCA
NM_001527.3       TGTCCAGTGTTTGATGGACTCTTTGAGTTTTGTCAGCTCTCAACTGGCGGTTCAGTTGCT
NM_004964.2       TGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCA
                  ********.** *****.** ******** ****** * **:***** *****:** **:

HsCD00001873      AGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTG
NM_001527.3       GGAGCTGTGAAGTTAAACCGACAACAGACTGATATGGCTGTTAATTGGGCTGGAGGATTA
NM_004964.2       AGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTG
                  .*:********. *:** ...**.***** ** ** ***** ***********.**. *.

HsCD00001873      CACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCC
NM_001527.3       CATCATGCTAAGAAATCAGAAGCATCAGGATTCTGTTACGTTAATGATATTGTGCTTGCC
NM_004964.2       CACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCC
                  ** *****:*****.**.**.*****:**.*********** ******** **  * ***

HsCD00001873      ATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACATTGACATTGATATTCACCAT
NM_001527.3       ATCCTTGAATTACTAAAGTATCATCAGAGAGTCTTATATATTGATATAGATATTCATCAT
NM_004964.2       ATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACATTGACATTGATATTCACCAT
                  ***** *** *.*********** *****.**  *.** ***** **:******** ***

HsCD00001873      GGTGACGGCGTGGAAGAGGCCTTCTACACCACGGACCGGGTCATGACTGTGTCCTTTCAT
NM_001527.3       GGTGATGGTGTTGAAGAAGCTTTTTATACAACAGATCGTGTAATGACGGTATCATTCCAT
NM_004964.2       GGTGACGGCGTGGAAGAGGCCTTCTACACCACGGACCGGGTCATGACTGTGTCCTTTCAT
                  ***** ** ** *****.** ** ** **.**.** ** **.***** **.**.** ***

HsCD00001873      AAGTATGGAGAGTACTTCCCAGGAACTGGGGACCTACGGGATATCGGGGCTGGCAAAGGC
NM_001527.3       AAATATGGGGAATACTTTCCTGGCACAGGAGACTTGAGGGATATTGGTGCTGGAAAAGGC
NM_004964.2       AAGTATGGAGAGTACTTCCCAGGAACTGGGGACCTACGGGATATCGGGGCTGGCAAAGGC
                  **.*****.**.***** **:**.**:**.*** *..******* ** *****.******

HsCD00001873      AAGTATTATGCTGTTAACTACCCGCTCCGAGACGGGATTGATGACGAGTCCTATGAGGCC
NM_001527.3       AAATACTATGCTGTCAATTTTCCAATGAGAGATGGTATAGATGATGAGTCATATGGGCAG
NM_004964.2       AAGTATTATGCTGTTAACTACCCGCTCCGAGACGGGATTGATGACGAGTCCTATGAGGCC
                  **.** ******** ** *: **..* .**** ** **:***** *****.****.* . 

HsCD00001873      ATTTTCAAGCCGGTCATGTCCAAAGTAATGGAGATGTTCCAGCCTAGTGCGGTGGTCTTA
NM_001527.3       ATATTTAAGCCTATTATCTCAAAGGTGATGGAGATGTATCAACCTAGTGCTGTGGTATTA
NM_004964.2       ATTTTCAAGCCGGTCATGTCCAAAGTAATGGAGATGTTCCAGCCTAGTGCGGTGGTCTTA
                  **:** ***** .* ** **.**.**.**********: **.******** *****.***

HsCD00001873      CAGTGTGGCTCAGACTCCCTATCTGGGGATCGGTTAGGTTGCTTCAATCTAACTATCAAA
NM_001527.3       CAGTGTGGTGCAGACTCATTATCTGGTGATAGACTGGGTTGTTTCAATCTAACAGTCAAA
NM_004964.2       CAGTGTGGCTCAGACTCCCTATCTGGGGATCGGTTAGGTTGCTTCAATCTAACTATCAAA
                  ********  *******. ******* ***.*. *.***** ***********:.*****

HsCD00001873      GGACACGCCAAGTGTGTGGAATTTGTCAAGAGCTTTAACCTGCCTATGCTGATGCTGGGA
NM_001527.3       GGTCATGCTAAATGTGTAGAAGTTGTAAAAACTTTTAACTTACCATTACTGATGCTTGGA
NM_004964.2       GGACACGCCAAGTGTGTGGAATTTGTCAAGAGCTTTAACCTGCCTATGCTGATGCTGGGA
                  **:** ** **.*****.*** ****.**.*  ****** *.**::*.******** ***

HsCD00001873      GGCGGTGGTTACACCATTCGTAACGTTGCCCGGTGCTGGACATATGAGACAGCTGTGGCC
NM_001527.3       GGAGGTGGCTACACAATCCGTAATGTTGCTCGATGTTGGACATATGAGACTGCAGTTGCC
NM_004964.2       GGCGGTGGTTACACCATTCGTAACGTTGCCCGGTGCTGGACATATGAGACAGCTGTGGCC
                  **.***** *****.** ***** ***** **.** **************:**:** ***

HsCD00001873      CTGGATACGGAGATCCCTAATGAGCTTCCATACAATGACTACTTTGAATACTTTGGACCA
NM_001527.3       CTTGATTGTGAGATTCCCAATGAGTTGCCATATAATGATTACTTTGAGTATTTTGGACCA
NM_004964.2       CTGGATACGGAGATCCCTAATGAGCTTCCATACAATGACTACTTTGAATACTTTGGACCA
                  ** ***:  ***** ** ****** * ***** ***** ********.** *********

HsCD00001873      GATTTCAAGCTCCACATCAGTCCTTCCAATATGACTAACCAGAACACGAATGAGTACCTG
NM_001527.3       GACTTCAAACTGCATATTAGTCCTTCAAACATGACAAACCAGAACACTCCAGAATATATG
NM_004964.2       GATTTCAAGCTCCACATCAGTCCTTCCAATATGACTAACCAGAACACGAATGAGTACCTG
                  ** *****.** ** ** ********.** *****:*********** ..:**.** .**

HsCD00001873      GAGAAGATCAAACAGCGACTGTTTGAGAACCTTAGAATGCTGCCGCACGCACCTGGGGTC
NM_001527.3       GAAAAGATAAAACAGCGTTTGTTTGAAAATTTGCGCATGTTACCTCATGCACCTGGTGTC
NM_004964.2       GAGAAGATCAAACAGCGACTGTTTGAGAACCTTAGAATGCTGCCGCACGCACCTGGGGTC
                  **.*****.********: *******.**  * .*.*** *.** ** ******** ***

HsCD00001873      CAAATGCAGGCGATTCCTGAGGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGAC
NM_001527.3       CAGATGCAAGCTATTCCAGAAGATGCTGTTCATGAAGACAGTGGAGATGAAGATGGAGAA
NM_004964.2       CAAATGCAGGCGATTCCTGAGGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGAC
                  **.*****.** *****:**.** ** .* *.***.** *****.*****.** *.***.

HsCD00001873      GACCCTGACAAGCGCATCTCGATCTGCTCCTCTGACAAACGAATTGCCTGTGAGGAAGAG
NM_001527.3       GATCCAGACAAGAGAATTTCTATTCGAGCATCAGACAAGCGGATAGCTTGTGATGAAGAA
NM_004964.2       GACCCTGACAAGCGCATCTCGATCTGCTCCTCTGACAAACGAATTGCCTGTGAGGAAGAG
                  ** **:******.*.** ** **  *. *.**:*****.**.**:** ***** *****.

HsCD00001873      TTCTCCGATTCTGAAGAGGAGGGAGAGGGGGGCCGCAAGAACTCTTCCAACTTCAAAAAA
NM_001527.3       TTCTCAGATTCTGAGGATGAAGGAGAAGGAGGTCGAAGAAATGTGGCTGATCATAAGAAA
NM_004964.2       TTCTCCGATTCTGAAGAGGAGGGAGAGGGGGGCCGCAAGAACTCTTCCAACTTCAAAAAA
                  *****.********.** **.*****.**.** **.*..**     * .*  : **.***

HsCD00001873      GCCAAGAGAGTCAAAACAGAGGATGAAAAAGAGAAAGACCCAGAGGAGAAGAAAGAAGTC
NM_001527.3       GGAGCAAAGAAAGCTAGAATTGAAGAAGATAAGAAAGAAACAGAGGACAAAAAAACAGAC
NM_004964.2       GCCAAGAGAGTCAAAACAGAGGATGAAAAAGAGAAAGACCCAGAGGAGAAGAAAGAAGTC
                  * ....*...:...:* *.: **:***.*:.*******..******* **.***..**:*

HsCD00001873      ACCGAAGAGGAGAAAACCAAGGAGGAGAAGCCAGAAGCCAAAGGGGTCAAGGAGGAGGTC
NM_001527.3       GTTAAGGAAGAAGATAAATCCAAGGACAACAGTGGTGAAAAAACAGATACCAAAGGAACC
NM_004964.2       ACCGAAGAGGAGAAAACCAAGGAGGAGAAGCCAGAAGCCAAAGGGGTCAAGGAGGAGGTC
                  .  .*.**.**..*:*..:. .**** ** . :*.:*..***. .*: *. .*.*... *

HsCD00001873      AAGTTGGCCTTG---------------
NM_001527.3       AAATCAGAACAGCTCAGCAACCCCTGA
NM_004964.2       AAGTTGGCCTGA---------------
                  **.* .*..  .               

Pathways

NCI : E2F transcription factor network
NCI : Glucocorticoid receptor regulatory network
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : IL3-mediated signaling events
NCI : Notch signaling pathway
NCI : Notch-mediated HES/HEY network
NCI : Presenilin action in Notch and Wnt signaling
NCI : Regulation of Androgen receptor activity
NCI : Regulation of Telomerase
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Regulation of retinoblastoma protein
NCI : Retinoic acid receptors-mediated signaling
NCI : Signaling events mediated by HDAC Class I
NCI : Sumoylation by RanBP2 regulates transcriptional repression
NCI : Validated nuclear estrogen receptor alpha network
NCI : Validated targets of C-MYC transcriptional repression
Panther : Wnt signaling pathway
Panther : p53 pathway
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants
Reactome : Constitutive Signaling by NOTCH1 PEST Domain Mutants
Reactome : Disease
Reactome : Downregulation of SMAD2/3:SMAD4 transcriptional activity
Reactome : Epigenetic regulation of gene expression
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : G0 and Early G1
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Hemostasis
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : Mitotic G1-G1/S phases
Reactome : NOTCH1 Intracellular Domain Regulates Transcription
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I Transcription Initiation
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : Signaling by Wnt
Reactome : Signalling by NGF
Reactome : TCF dependent signaling in response to WNT
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Transcription
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
Reactome : deactivation of the beta-catenin transactivating complex
Reactome : formation of the beta-catenin:TCF transactivating complex
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR negatively regulates cell cycle via SC1
WikiPathway : Androgen receptor signaling pathway
WikiPathway : Cell cycle
WikiPathway : Energy Metabolism
WikiPathway : IL-6 signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Neural Crest Differentiation
WikiPathway : Notch Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TWEAK Signaling Pathway

Protein

UniProt : Q6IT96
UniProt : Q13547
HPRD : 03143

Clone

Cloning Information : 14187
HIP Master Clone ID : 28386
Original Clone ID : FLH014187.01L

Organism


TAX_ID : 9606
Species Specific ID: 3065

Genome

Chromosome : 1
Map Location : 1p34
Ensembl : ENSG00000116478

Reagents

Labome : HDAC1-antibody