DNASU Plasmid Repository • 480.965.5697 | Email

IL8 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IL8
Gene Name:  interleukin 8
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH110781.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00002059

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 300nts         Open reading frame : 1 to 300
Reference Sequence Alignment

ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT
GAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC
TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC
TGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC
AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 340
Start on reference sequence 41
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IL8
Symbol Nomenclature : IL8
SYNONYM : CXCL8; GCP-1; GCP1; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP-1; NAP1
Designation : T-cell chemotactic factor|alveolar macrophage chemotactic factor I|beta endothelial cell-derived neutrophil activating peptide|beta-thromboglobulin-like protein|chemokine (C-X-C motif) ligand 8|emoctakin|granulocyte chemotactic protein 1|interleukin-8|lung giant cell carcinoma-derived chemotactic protein|lymphocyte derived neutrophil activating peptide|monocyte-derived neutrophil chemotactic factor|monocyte-derived neutrophil-activating peptide|neutrophil-activating peptide 1|small inducible cytokine subfamily B, member 8|tumor necrosis factor-induced gene 1
Full Nomenclature : interleukin 8
GENEID : 3576
GI : 61370014
GenBank Accession : AY891500
HGNC : 6025
MIM : 146930
Vega : OTTHUMG00000151316
Target GenBank: BC013615

 

Reference Sequence Alignment

  

HsCD00002059      ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT
NM_000584.3       ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT
                  ************************************************************

HsCD00002059      GAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC
NM_000584.3       GAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC
                  ************************************************************

HsCD00002059      TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC
NM_000584.3       TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC
                  ************************************************************

HsCD00002059      TGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC
NM_000584.3       TGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC
                  ************************************************************

HsCD00002059      AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATTG
NM_000584.3       AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAA
                  **********************************************************:.

Pathways

NCI : AP-1 transcription factor network
NCI : ATF-2 transcription factor network
NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Glucocorticoid receptor regulatory network
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : IL8-mediated signaling events
NCI : LPA receptor mediated events
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Syndecan-2-mediated signaling events
NCI : Syndecan-3-mediated signaling events
NCI : Validated transcriptional targets of AP1 family members Fra1 and Fra2
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Interleukin signaling pathway
WikiPathway : EBV LMP1 signaling
WikiPathway : IL-3 Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : SIDS Susceptibility Pathways
WikiPathway : Senescence and Autophagy
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 110781
HIP Master Clone ID : 87064
Original Clone ID : FLH110781.01L

Organism


TAX_ID : 9606
Species Specific ID: 3576

Genome

Chromosome : 4
Map Location : 4q13-q21
Ensembl : ENSG00000169429

Reagents

Labome : IL-8-antibody