DNASU Plasmid Repository • 480.965.5697 | Email

EIF3S2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  EIF3I
Gene Name:  eukaryotic translation initiation factor 3, subunit I
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH118026.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000209

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 978nts         Open reading frame : 1 to 978
Reference Sequence Alignment

ATGAAGCCGATCCTACTGCAGGGCCATGAGCGGTCCATTACGCAGATTAAGTATAACCGC
GAAGGAGACCTCCTCTTTACTGTGGCCAAGGACCCTATCGTCAATGTATGGTACTCTGTG
AATGGTGAGAGGCTGGGCACCTACATGGGCCATACCGGAGCTGTGTGGTGTGTGGACGCT
GACTGGGACACCAAGCATGTCCTCACTGGCTCAGCTGACAACAGCTGTCGTCTCTGGGAC
TGTGAAACAGGAAAGCAGCTGGCCCTTCTCAAGACCAATTCGGCTGTCCGGACCTGCGGT
TTTGACTTTGGGGGCAACATCATCATGTTCTCCACGGACAAGCAGATGGGCTACCAGTGC
TTTGTGAGCTTTTTTGACCTGCGGGATCCGAGCCAGATTGACAACAATGAGCCCTACATG
AAGATCCCTTGCAATGACTCTAAAATCACCAGTGCTGTTTGGGGACCCCTGGGGGAGTGC
ATCATCGCTGGCCATGAGAGTGGAGAGCTCAACCAGTATAGTGCCAAGTCTGGAGAGGTG
TTGGTGAATGTTAAGGAGCACTCCCGGCAGATCAACGACATCCAGTTATCCAGGGACATG
ACCATGTTTGTGACCGCGTCCAAGGACAACACAGCCAAGCTTTTTGACTCCACAACTCTT
GAACATCAGAAGACTTTCCGGACAGAACGTCCTGTCAACTCAGCTGCCCTCTCCCCCAAC
TATGACCATGTGGTCCTGGGCGGTGGTCAGGAAGCCATGGATGTAACCACAACCTCCACC
AGGATTGGCAAGTTTGAGGCCAGGTTCTTCCATTTGGCCTTTGAAGAAGAGTTTGGAAGA
GTCAAGGGTCACTTTGGACCTATCAACAGTGTTGCCTTCCATCCTGATGGCAAGAGCTAC
AGCAGCGGCGGCGAAGATGGTTACGTCCGTATCCATTACTTCGACCCACAGTACTTTGAA
TTTGAGTTTGAGGCTTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 995
Start on reference sequence 18
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : EIF3I
Symbol Nomenclature : EIF3I
SYNONYM : EIF3S2; PRO2242; TRIP-1; TRIP1; eIF3-beta; eIF3-p36
Designation : TGF-beta receptor-interacting protein 1|TGFbeta receptor-interacting protein 1|eIF-3-beta|eIF3 p36|eukaryotic translation initiation factor 3 subunit 2|eukaryotic translation initiation factor 3 subunit I|eukaryotic translation initiation factor 3, subunit 2 (beta, 36kD)|eukaryotic translation initiation factor 3, subunit 2 beta, 36kDa|predicted protein of HQ2242
Full Nomenclature : eukaryotic translation initiation factor 3, subunit I
GENEID : 8668
Locus Tag : RP4-675E8.1
GI : 61355113
GenBank Accession : AY888156
HGNC : 3272
MIM : 603911
Vega : OTTHUMG00000007364
Target GenBank: NM_003757

 

Reference Sequence Alignment

  

HsCD00000209      ATGAAGCCGATCCTACTGCAGGGCCATGAGCGGTCCATTACGCAGATTAAGTATAACCGC
NM_003757.2       ATGAAGCCGATCCTACTGCAGGGCCATGAGCGGTCCATTACGCAGATTAAGTATAACCGC
                  ************************************************************

HsCD00000209      GAAGGAGACCTCCTCTTTACTGTGGCCAAGGACCCTATCGTCAATGTATGGTACTCTGTG
NM_003757.2       GAAGGAGACCTCCTCTTTACTGTGGCCAAGGACCCTATCGTCAATGTATGGTACTCTGTG
                  ************************************************************

HsCD00000209      AATGGTGAGAGGCTGGGCACCTACATGGGCCATACCGGAGCTGTGTGGTGTGTGGACGCT
NM_003757.2       AATGGTGAGAGGCTGGGCACCTACATGGGCCATACCGGAGCTGTGTGGTGTGTGGACGCT
                  ************************************************************

HsCD00000209      GACTGGGACACCAAGCATGTCCTCACTGGCTCAGCTGACAACAGCTGTCGTCTCTGGGAC
NM_003757.2       GACTGGGACACCAAGCATGTCCTCACTGGCTCAGCTGACAACAGCTGTCGTCTCTGGGAC
                  ************************************************************

HsCD00000209      TGTGAAACAGGAAAGCAGCTGGCCCTTCTCAAGACCAATTCGGCTGTCCGGACCTGCGGT
NM_003757.2       TGTGAAACAGGAAAGCAGCTGGCCCTTCTCAAGACCAATTCGGCTGTCCGGACCTGCGGT
                  ************************************************************

HsCD00000209      TTTGACTTTGGGGGCAACATCATCATGTTCTCCACGGACAAGCAGATGGGCTACCAGTGC
NM_003757.2       TTTGACTTTGGGGGCAACATCATCATGTTCTCCACGGACAAGCAGATGGGCTACCAGTGC
                  ************************************************************

HsCD00000209      TTTGTGAGCTTTTTTGACCTGCGGGATCCGAGCCAGATTGACAACAATGAGCCCTACATG
NM_003757.2       TTTGTGAGCTTTTTTGACCTGCGGGATCCGAGCCAGATTGACAACAATGAGCCCTACATG
                  ************************************************************

HsCD00000209      AAGATCCCTTGCAATGACTCTAAAATCACCAGTGCTGTTTGGGGACCCCTGGGGGAGTGC
NM_003757.2       AAGATCCCTTGCAATGACTCTAAAATCACCAGTGCTGTTTGGGGACCCCTGGGGGAGTGC
                  ************************************************************

HsCD00000209      ATCATCGCTGGCCATGAGAGTGGAGAGCTCAACCAGTATAGTGCCAAGTCTGGAGAGGTG
NM_003757.2       ATCATCGCTGGCCATGAGAGTGGAGAGCTCAACCAGTATAGTGCCAAGTCTGGAGAGGTG
                  ************************************************************

HsCD00000209      TTGGTGAATGTTAAGGAGCACTCCCGGCAGATCAACGACATCCAGTTATCCAGGGACATG
NM_003757.2       TTGGTGAATGTTAAGGAGCACTCCCGGCAGATCAACGACATCCAGTTATCCAGGGACATG
                  ************************************************************

HsCD00000209      ACCATGTTTGTGACCGCGTCCAAGGACAACACAGCCAAGCTTTTTGACTCCACAACTCTT
NM_003757.2       ACCATGTTTGTGACCGCGTCCAAGGACAACACAGCCAAGCTTTTTGACTCCACAACTCTT
                  ************************************************************

HsCD00000209      GAACATCAGAAGACTTTCCGGACAGAACGTCCTGTCAACTCAGCTGCCCTCTCCCCCAAC
NM_003757.2       GAACATCAGAAGACTTTCCGGACAGAACGTCCTGTCAACTCAGCTGCCCTCTCCCCCAAC
                  ************************************************************

HsCD00000209      TATGACCATGTGGTCCTGGGCGGTGGTCAGGAAGCCATGGATGTAACCACAACCTCCACC
NM_003757.2       TATGACCATGTGGTCCTGGGCGGTGGTCAGGAAGCCATGGATGTAACCACAACCTCCACC
                  ************************************************************

HsCD00000209      AGGATTGGCAAGTTTGAGGCCAGGTTCTTCCATTTGGCCTTTGAAGAAGAGTTTGGAAGA
NM_003757.2       AGGATTGGCAAGTTTGAGGCCAGGTTCTTCCATTTGGCCTTTGAAGAAGAGTTTGGAAGA
                  ************************************************************

HsCD00000209      GTCAAGGGTCACTTTGGACCTATCAACAGTGTTGCCTTCCATCCTGATGGCAAGAGCTAC
NM_003757.2       GTCAAGGGTCACTTTGGACCTATCAACAGTGTTGCCTTCCATCCTGATGGCAAGAGCTAC
                  ************************************************************

HsCD00000209      AGCAGCGGCGGCGAAGATGGTTACGTCCGTATCCATTACTTCGACCCACAGTACTTTGAA
NM_003757.2       AGCAGCGGCGGCGAAGATGGTTACGTCCGTATCCATTACTTCGACCCACAGTACTTCGAA
                  ******************************************************** ***

HsCD00000209      TTTGAGTTTGAGGCTTAA
NM_003757.2       TTTGAGTTTGAGGCTTAA
                  ******************

Pathways

Reactome : 3' -UTR-mediated translational regulation
Reactome : Activation of the mRNA upon binding of the cap-binding complex and eIFs, and subsequent binding to 43S
Reactome : Cap-dependent Translation Initiation
Reactome : Eukaryotic Translation Initiation
Reactome : Formation of a pool of free 40S subunits
Reactome : Formation of the ternary complex, and subsequently, the 43S complex
Reactome : GTP hydrolysis and joining of the 60S ribosomal subunit
Reactome : Gene Expression
Reactome : L13a-mediated translational silencing of Ceruloplasmin expression
Reactome : Metabolism of proteins
Reactome : Ribosomal scanning and start codon recognition
Reactome : Translation
Reactome : Translation initiation complex formation
WikiPathway : Translation Factors

Protein

SMART domain : WD40 : WD40 repeats
UniProt : Q5U0F4
UniProt : Q13347
HPRD : 04884

Clone

Cloning Information : 118026
HIP Master Clone ID : 93872
Original Clone ID : FLH118026.01X

Organism


TAX_ID : 9606
Species Specific ID: 8668

Genome

Chromosome : 1
Map Location : 1p34.1
Ensembl : ENSG00000084623

Reagents

Labome : EIF3I-antibody