DNASU Plasmid Repository • 480.965.5697 | Email

XLKD1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  LYVE1
Gene Name:  lymphatic vessel endothelial hyaluronan receptor 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH135268.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00021263

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 969nts         Open reading frame : 1 to 969
Reference Sequence Alignment

ATGGCCAGGTGCTTCAGCCTGGTGTTGCTTCTCACTTCCATCTGGACCACGAGGCTCCTG
GTCCAAGGCTCTTTGCGTGCAGAAGAGCTTTCCATCCAGGTGTCATGCAGAATTATGGGG
ATCACCCTTGTGAGCAAAAAGGCGAACCAGCAGCTGAATTTCACAGAAGCTAAGGAGGCC
TGTAGGCTGCTGGGACTAAGTTTGGCCGGCAAGGACCAAGTTGAAACAGCCTTGAAAGCT
AGCTTTGAAACTTGCAGCTATGGCTGGGTTGGAGATGGATTCGTGGTCATCTCTAGGATT
AGCCCAAACCCCAAGTGTGGGAAAAATGGGGTGGGTGTCCTGATTAGGAAGGTTCCAGTG
AGCCGACAGTTTGCAGCCTATTGTTACAACTCATCTGATACTTGGACTAACTCGTGCATT
CCAGAAATTATCACCACCAAAGATCCCATATTCAACACTCAAACTGCAACACAAACAACA
GAATTTATTGTCAGTGACAGTACCTACTCGGTGGCATCCCCTTACTCTACAATACCTGCC
CCTACTACTACTCCTCCTGCTCCAGCTTCCACTTCTATTCCACGGAGAAAAAAATTGATT
TGTGTCACAGAAGTTTTTATGGAAACTAGCACCATGTCTACAGAAACTGAACCATTTGTT
GAAAATAAAGCAGCATTCAAGAATGAAGCTGCTGGGTTTGGAGGTGTCCCCACGGCTCTG
CTAGTGCTTGCTCTCCTCTTCTTTGGTGCTGCAGCTGGTCTTGGATTTTGCTATGTCAAA
AGGTATGTGAAGGCCTTCCCTTTTACAAACAAGAATCAGCAGAAGGAAATGATCGAAACC
AAAGTAGTAAAGGAGGAGAAGGCCAATGATAGCAACCCTAATGAGGAATCAAAGAAAACT
GATAAAAACCCAGAAGAGTCCAAGAGTCCAAGCAAAACTACCGTGCGATGCCTGGAAGCT
GAAGTTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1014
Start on reference sequence 46
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : LYVE1
Symbol Nomenclature : LYVE1
SYNONYM : CRSBP-1; HAR; LYVE-1; XLKD1
Designation : cell surface retention sequence binding protein-1|cell surface retention sequence-binding protein 1|extracellular link domain containing 1|extracellular link domain-containing 1|extracellular link domain-containing protein 1|hyaluronic acid receptor|lymphatic vessel endothelial hyaluronic acid receptor 1
Full Nomenclature : lymphatic vessel endothelial hyaluronan receptor 1
GENEID : 10894
Locus Tag : UNQ230/PRO263
HGNC : 14687
MIM : 605702
Target GenBank: BC026231

 

Reference Sequence Alignment

  

HsCD00021263      ATGGCCAGGTGCTTCAGCCTGGTGTTGCTTCTCACTTCCATCTGGACCACGAGGCTCCTG
NM_006691.3       ATGGCCAGGTGCTTCAGCCTGGTGTTGCTTCTCACTTCCATCTGGACCACGAGGCTCCTG
                  ************************************************************

HsCD00021263      GTCCAAGGCTCTTTGCGTGCAGAAGAGCTTTCCATCCAGGTGTCATGCAGAATTATGGGG
NM_006691.3       GTCCAAGGCTCTTTGCGTGCAGAAGAGCTTTCCATCCAGGTGTCATGCAGAATTATGGGG
                  ************************************************************

HsCD00021263      ATCACCCTTGTGAGCAAAAAGGCGAACCAGCAGCTGAATTTCACAGAAGCTAAGGAGGCC
NM_006691.3       ATCACCCTTGTGAGCAAAAAGGCGAACCAGCAGCTGAATTTCACAGAAGCTAAGGAGGCC
                  ************************************************************

HsCD00021263      TGTAGGCTGCTGGGACTAAGTTTGGCCGGCAAGGACCAAGTTGAAACAGCCTTGAAAGCT
NM_006691.3       TGTAGGCTGCTGGGACTAAGTTTGGCCGGCAAGGACCAAGTTGAAACAGCCTTGAAAGCT
                  ************************************************************

HsCD00021263      AGCTTTGAAACTTGCAGCTATGGCTGGGTTGGAGATGGATTCGTGGTCATCTCTAGGATT
NM_006691.3       AGCTTTGAAACTTGCAGCTATGGCTGGGTTGGAGATGGATTCGTGGTCATCTCTAGGATT
                  ************************************************************

HsCD00021263      AGCCCAAACCCCAAGTGTGGGAAAAATGGGGTGGGTGTCCTGATTAGGAAGGTTCCAGTG
NM_006691.3       AGCCCAAACCCCAAGTGTGGGAAAAATGGGGTGGGTGTCCTGATTTGGAAGGTTCCAGTG
                  *********************************************:**************

HsCD00021263      AGCCGACAGTTTGCAGCCTATTGTTACAACTCATCTGATACTTGGACTAACTCGTGCATT
NM_006691.3       AGCCGACAGTTTGCAGCCTATTGTTACAACTCATCTGATACTTGGACTAACTCGTGCATT
                  ************************************************************

HsCD00021263      CCAGAAATTATCACCACCAAAGATCCCATATTCAACACTCAAACTGCAACACAAACAACA
NM_006691.3       CCAGAAATTATCACCACCAAAGATCCCATATTCAACACTCAAACTGCAACACAAACAACA
                  ************************************************************

HsCD00021263      GAATTTATTGTCAGTGACAGTACCTACTCGGTGGCATCCCCTTACTCTACAATACCTGCC
NM_006691.3       GAATTTATTGTCAGTGACAGTACCTACTCGGTGGCATCCCCTTACTCTACAATACCTGCC
                  ************************************************************

HsCD00021263      CCTACTACTACTCCTCCTGCTCCAGCTTCCACTTCTATTCCACGGAGAAAAAAATTGATT
NM_006691.3       CCTACTACTACTCCTCCTGCTCCAGCTTCCACTTCTATTCCACGGAGAAAAAAATTGATT
                  ************************************************************

HsCD00021263      TGTGTCACAGAAGTTTTTATGGAAACTAGCACCATGTCTACAGAAACTGAACCATTTGTT
NM_006691.3       TGTGTCACAGAAGTTTTTATGGAAACTAGCACCATGTCTACAGAAACTGAACCATTTGTT
                  ************************************************************

HsCD00021263      GAAAATAAAGCAGCATTCAAGAATGAAGCTGCTGGGTTTGGAGGTGTCCCCACGGCTCTG
NM_006691.3       GAAAATAAAGCAGCATTCAAGAATGAAGCTGCTGGGTTTGGAGGTGTCCCCACGGCTCTG
                  ************************************************************

HsCD00021263      CTAGTGCTTGCTCTCCTCTTCTTTGGTGCTGCAGCTGGTCTTGGATTTTGCTATGTCAAA
NM_006691.3       CTAGTGCTTGCTCTCCTCTTCTTTGGTGCTGCAGCTGGTCTTGGATTTTGCTATGTCAAA
                  ************************************************************

HsCD00021263      AGGTATGTGAAGGCCTTCCCTTTTACAAACAAGAATCAGCAGAAGGAAATGATCGAAACC
NM_006691.3       AGGTATGTGAAGGCCTTCCCTTTTACAAACAAGAATCAGCAGAAGGAAATGATCGAAACC
                  ************************************************************

HsCD00021263      AAAGTAGTAAAGGAGGAGAAGGCCAATGATAGCAACCCTAATGAGGAATCAAAGAAAACT
NM_006691.3       AAAGTAGTAAAGGAGGAGAAGGCCAATGATAGCAACCCTAATGAGGAATCAAAGAAAACT
                  ************************************************************

HsCD00021263      GATAAAAACCCAGAAGAGTCCAAGAGTCCAAGCAAAACTACCGTGCGATGCCTGGAAGCT
NM_006691.3       GATAAAAACCCAGAAGAGTCCAAGAGTCCAAGCAAAACTACCGTGCGATGCCTGGAAGCT
                  ************************************************************

HsCD00021263      GAAGTTTAG
NM_006691.3       GAAGTTTAG
                  *********

Pathways

Reactome : Disease
Reactome : Glycogen storage diseases
Reactome : Glycosaminoglycan metabolism
Reactome : Hyaluronan metabolism
Reactome : Hyaluronan uptake and degradation
Reactome : MPS I - Hurler syndrome
Reactome : MPS II - Hunter syndrome
Reactome : MPS IIIA - Sanfilippo syndrome A
Reactome : MPS IIIB - Sanfilippo syndrome B
Reactome : MPS IIIC - Sanfilippo syndrome C
Reactome : MPS IIID - Sanfilippo syndrome D
Reactome : MPS IV - Morquio syndrome A
Reactome : MPS IV - Morquio syndrome B
Reactome : MPS IX - Natowicz syndrome
Reactome : MPS VI - Maroteaux-Lamy syndrome
Reactome : MPS VII - Sly syndrome
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Mucopolysaccharidoses
Reactome : Myoclonic epilepsy of Lafora

Protein

SMART domain : LINK : Link (Hyaluronan-binding)
UniProt : B2R672
UniProt : Q9Y5Y7
HPRD : 05753

Clone

Cloning Information : 135268
HIP Master Clone ID : 111768
Original Clone ID : FLH135268.01X

Organism


TAX_ID : 9606
Species Specific ID: 10894

Genome

Chromosome : 11
Map Location : 11p15

Reagents

Labome : LYVE-1-antibody