DNASU Plasmid Repository • 480.965.5697 | Email

PKM2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PKM
Gene Name:  pyruvate kinase, muscle
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH172519.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00021372

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1596nts        
Open reading frame : 1 to 1596
Reference Sequence Alignment

ATGTCGAAGCCCCATAGTGAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCA
GCCATGGCTGACACATTCCTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATC
ACAGCCCGGAACACTGGCATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACG
TTGAAGGAGATGATTAAGTCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACT
CATGAGTACCATGCGGAGACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCT
GACCCCATCCTCTACCGGCCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGA
ACTGGGCTCATCAAGGGCAGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTC
AAAATCACGCTGGATAACGCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGAC
TACAAGAACATCTGCAAGGTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTT
ATTTCTCTCCAGGTGAAGCAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGT
GGCTCCTTGGGCAGCAAGAAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCT
GTGTCGGAGAAGGACATCCAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTG
TTTGCGTCATTCATCCGCAAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAG
AAGGGAAAGAACATCAAGATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTT
GATGAAATCCTGGAGGCCAGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAG
ATTCCTGCAGAGAAGGTCTTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCT
GGGAAGCCTGTCATCTGTGCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCC
ACTCGGGCTGAAGGCAGTGATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATG
CTGTCTGGAGAAACAGCCAAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTG
ATTGCCCGTGAGGCAGAGGCTGCCATCTACCACTTGCAATTATTTGAGGAACTCCGCCGC
CTGGCGCCCATTACCAGCGACCCCACAGAAGCCACCGCCGTGGGTGCCGTGGAGGCCTCC
TTCAAGTGCTGCAGTGGGGCCATAATCGTCCTCACCAAGTCTGGCAGGTCTGCTCACCAG
GTGGCCAGATACCGCCCACGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCT
CGTCAGGCCCACCTGTACCGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAG
GCCTGGGCTGAGGACGTGGACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGA
GGCTTCTTCAAGAAGGGAGATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGC
TTCACCAACACCATGCGTGTTGTTCCTGTGCCGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1684
Start on reference sequence 89
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PKM
Symbol Nomenclature : PKM
SYNONYM : CTHBP; HEL-S-30; OIP3; PK3; PKM2; TCB; THBP1
Designation : OIP-3|OPA-interacting protein 3|PK, muscle type|cytosolic thyroid hormone-binding protein|epididymis secretory protein Li 30|p58|pyruvate kinase 2/3|pyruvate kinase PKM|pyruvate kinase isozymes M1/M2|pyruvate kinase muscle isozyme|thyroid hormone-binding protein 1|thyroid hormone-binding protein, cytosolic|tumor M2-PK
Full Nomenclature : pyruvate kinase, muscle
GENEID : 5315
HGNC : 9021
MIM : 179050
Vega : OTTHUMG00000172709
Target GenBank: BC007640

 

Reference Sequence Alignment

  

HsCD00021372        ------------------------------------------------------------
NM_002654.4         ------------------------------------------------------------
XM_005254443.1      ------------------------------------------ATGACTCAACCTTTCAAT
NM_182471.2         ------------------------------------------------------------
NM_001206798.1      ------------------------------------------------------------
NM_182470.2         ------------------------------------------------------------
NM_001206796.1      ATGCAGTGGAGCTCAGAGAGAGGAGAACGGCTCCTCACGCCTGGGGCCTGCTCTTCAGAA
NM_001206799.1      ------------------------------------------------------------
                                                                                

HsCD00021372        ------------------------------------------------------------
NM_002654.4         ------------------------------------------------------------
XM_005254443.1      TATTCTGCTTTTGAGAGAATTATCTTCGCTGGCTCTCCAGGGCACACCGTATTCAGCTCT
NM_182471.2         ------------------------------------------------------------
NM_001206798.1      ------------------------------------------------------------
NM_182470.2         ------------------------------------------------------------
NM_001206796.1      GTCCCCAGCGCCGTTCCTTCCAGATCAGGCGGCTCTCCAGGGCACACCGTATTCAGCTCT
NM_001206799.1      ------------------------------------------------------------
                                                                                

HsCD00021372        ------------------------------------------------------------
NM_002654.4         ------------------------------------------------------------
XM_005254443.1      GAGCGGTCTTTGCTAGTGAGGCCAAGGAGCCACCCTGAGCCAAAAGGGGAGCATTATGTC
NM_182471.2         ------------------------------------------------------------
NM_001206798.1      -------------------------------------------------------ATGTC
NM_182470.2         ------------------------------------------------------------
NM_001206796.1      GAGCGGTCTTTGCTAGTGAGGCCAAGGAGCCACCCTGAGCCAAAAGGGGAGCATTATGTC
NM_001206799.1      ------------------------------------------------------------
                                                                                

HsCD00021372        ------------------------------------------ATGTCGAAGCCCCATAGT
NM_002654.4         ------------------------------------------ATGTCGAAGCCCCATAGT
XM_005254443.1      ACCGGAAGCCCAACCCCAGAGAACCAAAGGACCTCAGCAGCCATGTCGAAGCCCCATAGT
NM_182471.2         ------------------------------------------ATGTCGAAGCCCCATAGT
NM_001206798.1      ACCGGAAGCCCAACCCCAGAGAACCAAAGGACCTCAGCAGCCATGTCGAAGCCCCATAGT
NM_182470.2         ------------------------------------------ATGTCGAAGCCCCATAGT
NM_001206796.1      ACCGGAAGCCCAACCCCAGAGAACCAAAGGACCTCAGCAGCCATGTCGAAGCCCCATAGT
NM_001206799.1      ---------------------------ATGACCTCAGCAGCCATGTCGAAGCCCCATAGT
                                                              ******************

HsCD00021372        GAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTC
NM_002654.4         GAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTC
XM_005254443.1      GAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTC
NM_182471.2         GAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTC
NM_001206798.1      GAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTC
NM_182470.2         GAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTC
NM_001206796.1      GAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTC
NM_001206799.1      GAAGCCGGGACTGCCTTCATTCAGACCCAGCAGCTGCACGCAGCCATGGCTGACACATTC
                    ************************************************************

HsCD00021372        CTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGC
NM_002654.4         CTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGC
XM_005254443.1      CTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGC
NM_182471.2         CTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGC
NM_001206798.1      CTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGC
NM_182470.2         CTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGC
NM_001206796.1      CTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGC
NM_001206799.1      CTGGAGCACATGTGCCGCCTGGACATTGATTCACCACCCATCACAGCCCGGAACACTGGC
                    ************************************************************

HsCD00021372        ATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAG
NM_002654.4         ATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAG
XM_005254443.1      ATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAG
NM_182471.2         ATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAG
NM_001206798.1      ATCATCTGTACCATTG--------------------------------------------
NM_182470.2         ATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAG
NM_001206796.1      ATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAG
NM_001206799.1      ATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAG
                    ****************                                            

HsCD00021372        TCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAG
NM_002654.4         TCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAG
XM_005254443.1      TCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAG
NM_182471.2         TCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAG
NM_001206798.1      ------------------------------------------------TACCATGCGGAG
NM_182470.2         TCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAG
NM_001206796.1      TCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAG
NM_001206799.1      TCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAG
                                                                    ************

HsCD00021372        ACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGG
NM_002654.4         ACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGG
XM_005254443.1      ACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGG
NM_182471.2         ACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGG
NM_001206798.1      ACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGG
NM_182470.2         ACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGG
NM_001206796.1      ACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGG
NM_001206799.1      ACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGG
                    ************************************************************

HsCD00021372        CCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGC
NM_002654.4         CCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGC
XM_005254443.1      CCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGC
NM_182471.2         CCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGC
NM_001206798.1      CCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGC
NM_182470.2         CCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGC
NM_001206796.1      CCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGC
NM_001206799.1      CCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGC
                    ************************************************************

HsCD00021372        AGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAAC
NM_002654.4         AGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAAC
XM_005254443.1      AGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAAC
NM_182471.2         AGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAAC
NM_001206798.1      AGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAAC
NM_182470.2         AGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAAC
NM_001206796.1      AGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAAC
NM_001206799.1      AGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAAC
                    ************************************************************

HsCD00021372        GCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAG
NM_002654.4         GCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAG
XM_005254443.1      GCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAG
NM_182471.2         GCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAG
NM_001206798.1      GCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAG
NM_182470.2         GCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAG
NM_001206796.1      GCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAG
NM_001206799.1      GCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAG
                    ************************************************************

HsCD00021372        GTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAG
NM_002654.4         GTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAG
XM_005254443.1      GTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAG
NM_182471.2         GTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAG
NM_001206798.1      GTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAG
NM_182470.2         GTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAG
NM_001206796.1      GTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAG
NM_001206799.1      GTGGTGGAAGTGGGCAGCAAGATCTACGTGGATGATGGGCTTATTTCTCTCCAGGTGAAG
                    ************************************************************

HsCD00021372        CAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAG
NM_002654.4         CAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAG
XM_005254443.1      CAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAG
NM_182471.2         CAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAG
NM_001206798.1      CAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAG
NM_182470.2         CAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAG
NM_001206796.1      CAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAG
NM_001206799.1      CAGAAAGGTGCCGACTTCCTGGTGACGGAGGTGGAAAATGGTGGCTCCTTGGGCAGCAAG
                    ************************************************************

HsCD00021372        AAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATC
NM_002654.4         AAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATC
XM_005254443.1      AAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATC
NM_182471.2         AAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATC
NM_001206798.1      AAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATC
NM_182470.2         AAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATC
NM_001206796.1      AAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATC
NM_001206799.1      AAGGGTGTGAACCTTCCTGGGGCTGCTGTGGACTTGCCTGCTGTGTCGGAGAAGGACATC
                    ************************************************************

HsCD00021372        CAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGC
NM_002654.4         CAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGC
XM_005254443.1      CAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGC
NM_182471.2         CAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGC
NM_001206798.1      CAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGC
NM_182470.2         CAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGC
NM_001206796.1      CAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGC
NM_001206799.1      CAGGATCTGAAGTTTGGGGTCGAGCAGGATGTTGATATGGTGTTTGCGTCATTCATCCGC
                    ************************************************************

HsCD00021372        AAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAG
NM_002654.4         AAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAG
XM_005254443.1      AAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAG
NM_182471.2         AAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAG
NM_001206798.1      AAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAG
NM_182470.2         AAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAG
NM_001206796.1      AAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAG
NM_001206799.1      AAGGCATCTGATGTCCATGAAGTTAGGAAGGTCCTGGGAGAGAAGGGAAAGAACATCAAG
                    ************************************************************

HsCD00021372        ATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCC
NM_002654.4         ATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCC
XM_005254443.1      ATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCC
NM_182471.2         ATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCC
NM_001206798.1      ATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCC
NM_182470.2         ATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCC
NM_001206796.1      ATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCC
NM_001206799.1      ATTATCAGCAAAATCGAGAATCATGAGGGGGTTCGGAGGTTTGATGAAATCCTGGAGGCC
                    ************************************************************

HsCD00021372        AGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTC
NM_002654.4         AGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTC
XM_005254443.1      AGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTC
NM_182471.2         AGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTC
NM_001206798.1      AGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTC
NM_182470.2         AGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTC
NM_001206796.1      AGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTC
NM_001206799.1      AGTGATGGGATCATGGTGGCTCGTGGTGATCTAGGCATTGAGATTCCTGCAGAGAAGGTC
                    ************************************************************

HsCD00021372        TTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGT
NM_002654.4         TTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGT
XM_005254443.1      TTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGT
NM_182471.2         TTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGT
NM_001206798.1      TTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGT
NM_182470.2         TTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGT
NM_001206796.1      TTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGT
NM_001206799.1      TTCCTTGCTCAGAAGATGATGATTGGACGGTGCAACCGAGCTGGGAAGCCTGTCATCTGT
                    ************************************************************

HsCD00021372        GCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGT
NM_002654.4         GCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGT
XM_005254443.1      GCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGT
NM_182471.2         GCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGT
NM_001206798.1      GCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGT
NM_182470.2         GCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGT
NM_001206796.1      GCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGT
NM_001206799.1      GCTACTCAGATGCTGGAGAGCATGATCAAGAAGCCCCGCCCCACTCGGGCTGAAGGCAGT
                    ************************************************************

HsCD00021372        GATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCC
NM_002654.4         GATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCC
XM_005254443.1      GATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCC
NM_182471.2         GATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCC
NM_001206798.1      GATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCC
NM_182470.2         GATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCC
NM_001206796.1      GATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCC
NM_001206799.1      GATGTGGCCAATGCAGTCCTGGATGGAGCCGACTGCATCATGCTGTCTGGAGAAACAGCC
                    ************************************************************

HsCD00021372        AAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATTGCCCGTGAGGCAGAG
NM_002654.4         AAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATTGCCCGTGAGGCAGAG
XM_005254443.1      AAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATTGCCCGTGAGGCAGAG
NM_182471.2         AAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATAGCTCGTGAGGCTGAG
NM_001206798.1      AAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATTGCCCGTGAGGCAGAG
NM_182470.2         AAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATAGCTCGTGAGGCTGAG
NM_001206796.1      AAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATAGCTCGTGAGGCTGAG
NM_001206799.1      AAAGGGGACTATCCTCTGGAGGCTGTGCGCATGCAGCACCTGATAGCTCGTGAGGCTGAG
                    ********************************************:** ********:***

HsCD00021372        GCTGCCATCTACCACTTGCAATTATTTGAGGAACTCCGCCGCCTGGCGCCCATTACCAGC
NM_002654.4         GCTGCCATCTACCACTTGCAATTATTTGAGGAACTCCGCCGCCTGGCGCCCATTACCAGC
XM_005254443.1      GCTGCCATCTACCACTTGCAATTATTTGAGGAACTCCGCCGCCTGGCGCCCATTACCAGC
NM_182471.2         GCAGCCATGTTCCACCGCAAGCTGTTTGAAGAACTTGTGCGAGCCTCAAGTCACTCCACA
NM_001206798.1      GCTGCCATCTACCACTTGCAATTATTTGAGGAACTCCGCCGCCTGGCGCCCATTACCAGC
NM_182470.2         GCAGCCATGTTCCACCGCAAGCTGTTTGAAGAACTTGTGCGAGCCTCAAGTCACTCCACA
NM_001206796.1      GCAGCCATGTTCCACCGCAAGCTGTTTGAAGAACTTGTGCGAGCCTCAAGTCACTCCACA
NM_001206799.1      GCAGCCATGTTCCACCGCAAGCTGTTTGAAGAACTTGTGCGAGCCTCAAGTCACTCCACA
                    **:***** *:****   .*. *.*****.*****    **.    *..  .: :*** .

HsCD00021372        GACCCCACAGAAGCCACCGCCGTGGGTGCCGTGGAGGCCTCCTTCAAGTGCTGCAGTGGG
NM_002654.4         GACCCCACAGAAGCCACCGCCGTGGGTGCCGTGGAGGCCTCCTTCAAGTGCTGCAGTGGG
XM_005254443.1      GACCCCACAGAAGCCACCGCCGTGGGTGCCGTGGAGGCCTCCTTCAAGTGCTGCAGTGGG
NM_182471.2         GACCTCATGGAAGCCATGGCCATGGGCAGCGTGGAGGCTTCTTATAAGTGTTTAGCAGCA
NM_001206798.1      GACCCCACAGAAGCCACCGCCGTGGGTGCCGTGGAGGCCTCCTTCAAGTGCTGCAGTGGG
NM_182470.2         GACCTCATGGAAGCCATGGCCATGGGCAGCGTGGAGGCTTCTTATAAGTGTTTAGCAGCA
NM_001206796.1      GACCTCATGGAAGCCATGGCCATGGGCAGCGTGGAGGCTTCTTATAAGTGTTTAGCAGCA
NM_001206799.1      GACCTCATGGAAGCCATGGCCATGGGCAGCGTGGAGGCTTCTTATAAGTGTTTAGCAGCA
                    **** ** .*******  ***.**** . ********* ** *: ***** * .. :* .

HsCD00021372        GCCATAATCGTCCTCACCAAGTCTGGCAGGTCTGCTCACCAGGTGGCCAGATACCGCCCA
NM_002654.4         GCCATAATCGTCCTCACCAAGTCTGGCAGGTCTGCTCACCAGGTGGCCAGATACCGCCCA
XM_005254443.1      GCCATAATCGTCCTCACCAAGTCTGGCAGGTCTGCTCACCAGGTGGCCAGATACCGCCCA
NM_182471.2         GCTTTGATAGTTCTGACGGAGTCTGGCAGGTCTGCTCACCAGGTGGCCAGATACCGCCCA
NM_001206798.1      GCCATAATCGTCCTCACCAAGTCTGGCAGGTCTGCTCACCAGGTGGCCAGATACCGCCCA
NM_182470.2         GCTTTGATAGTTCTGACGGAGTCTGGCAGGTCTGCTCACCAGGTGGCCAGATACCGCCCA
NM_001206796.1      GCTTTGATAGTTCTGACGGAGTCTGGCAGGTCTGCTCACCAGGTGGCCAGATACCGCCCA
NM_001206799.1      GCTTTGATAGTTCTGACGGAGTCTGGCAGGTCTGCTCACCAGGTGGCCAGATACCGCCCA
                    ** :*.**.** ** ** .*****************************************

HsCD00021372        CGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCTCGTCAGGCCCACCTGTAC
NM_002654.4         CGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCTCGTCAGGCCCACCTGTAC
XM_005254443.1      CGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCTCGTCAGGCCCACCTGTAC
NM_182471.2         CGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCTCGTCAGGCCCACCTGTAC
NM_001206798.1      CGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCTCGTCAGGCCCACCTGTAC
NM_182470.2         CGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCTCGTCAGGCCCACCTGTAC
NM_001206796.1      CGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCTCGTCAGGCCCACCTGTAC
NM_001206799.1      CGTGCCCCCATCATTGCTGTGACCCGGAATCCCCAGACAGCTCGTCAGGCCCACCTGTAC
                    ************************************************************

HsCD00021372        CGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAGGCCTGGGCTGAGGACGTG
NM_002654.4         CGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAGGCCTGGGCTGAGGACGTG
XM_005254443.1      CGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAGGCCTGGGCTGAGGACGTG
NM_182471.2         CGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAGGCCTGGGCTGAGGACGTG
NM_001206798.1      CGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAGGCCTGGGCTGAGGACGTG
NM_182470.2         CGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAGGCCTGGGCTGAGGACGTG
NM_001206796.1      CGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAGGCCTGGGCTGAGGACGTG
NM_001206799.1      CGTGGCATCTTCCCTGTGCTGTGCAAGGACCCAGTCCAGGAGGCCTGGGCTGAGGACGTG
                    ************************************************************

HsCD00021372        GACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGAGGCTTCTTCAAGAAGGGA
NM_002654.4         GACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGAGGCTTCTTCAAGAAGGGA
XM_005254443.1      GACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGAGGCTTCTTCAAGAAGGGA
NM_182471.2         GACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGAGGCTTCTTCAAGAAGGGA
NM_001206798.1      GACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGAGGCTTCTTCAAGAAGGGA
NM_182470.2         GACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGAGGCTTCTTCAAGAAGGGA
NM_001206796.1      GACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGAGGCTTCTTCAAGAAGGGA
NM_001206799.1      GACCTCCGGGTGAACTTTGCCATGAATGTTGGCAAGGCCCGAGGCTTCTTCAAGAAGGGA
                    ************************************************************

HsCD00021372        GATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGCTTCACCAACACCATGCGT
NM_002654.4         GATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGCTTCACCAACACCATGCGT
XM_005254443.1      GATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGCTTCACCAACACCATGCGT
NM_182471.2         GATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGCTTCACCAACACCATGCGT
NM_001206798.1      GATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGCTTCACCAACACCATGCGT
NM_182470.2         GATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGCTTCACCAACACCATGCGT
NM_001206796.1      GATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGCTTCACCAACACCATGCGT
NM_001206799.1      GATGTGGTCATTGTGCTGACCGGATGGCGCCCTGGCTCCGGCTTCACCAACACCATGCGT
                    ************************************************************

HsCD00021372        GTTGTTCCTGTGCCGTAG
NM_002654.4         GTTGTTCCTGTGCCGTGA
XM_005254443.1      GTTGTTCCTGTGCCGTGA
NM_182471.2         GTTGTTCCTGTGCCGTGA
NM_001206798.1      GTTGTTCCTGTGCCGTGA
NM_182470.2         GTTGTTCCTGTGCCGTGA
NM_001206796.1      GTTGTTCCTGTGCCGTGA
NM_001206799.1      GTTGTTCCTGTGCCGTGA
                    ****************..

Pathways

NCI : HIF-1-alpha transcription factor network
Panther : Glycolysis
Panther : Pyruvate metabolism
Reactome : Disease
Reactome : Glucose metabolism
Reactome : Glycogen storage diseases
Reactome : Glycolysis
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Myoclonic epilepsy of Lafora
WikiPathway : Epithelium TarBase
WikiPathway : Glycolysis and Gluconeogenesis
WikiPathway : Leukocyte TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Squamous cell TarBase

Protein

UniProt : B4DNK4
UniProt : B4DUU6
UniProt : P14618
HPRD : 01529

Clone

Cloning Information : 172519
HIP Master Clone ID : 146716
Original Clone ID : FLH172519.01X

Organism


TAX_ID : 9606
Species Specific ID: 5315

Genome

Chromosome : 15
Map Location : 15q22
Ensembl : ENSG00000067225

Reagents

Labome : PKM-antibody