DNASU Plasmid Repository • 480.965.5697 | Email

BRAF (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BRAF
Gene Name:  v-raf murine sarcoma viral oncogene homolog B
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH203960.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00021530

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2301nts         Open reading frame : 1 to 2301
Reference Sequence Alignment

ATGGCGGCGCTGAGCGGTGGCGGTGGTGGCGGCGCGGAGCCGGGCCAGGCTCTGTTCAAC
GGGGACATGGAGCCCGAGGCCGGCGCCGGCGCCGGCGCCGCGGCCTCTTCGGCTGCGGAC
CCTGCCATTCCGGAGGAGGTGTGGAATATCAAACAAATGATTAAGTTGACACAGGAACAT
ATAGAGGCCCTATTGGACAAATTTGGTGGGGAGCATAATCCACCATCAATATATCTGGAG
GCCTATGAAGAATACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTG
GAATCTCTGGGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTT
ACATCTTCTTCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAAT
CCCACAGATGTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTC
CTGCCCAACAAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
CTAAAGAAAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATT
CAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAA
GAATTGCATGTGGAAGTGTTGGAGAATGTTCCACTTACAACACACAACTTTGTACGAAAA
ACGTTTTTCACCTTAGCATTTTGTGACTTTTGTCGAAAGCTGCTTTTCCAGGGTTTCCGC
TGTCAAACATGTGGTTATAAATTTCACCAGCGTTGTAGTACAGAAGTTCCACTGATGTGT
GTTAATTATGACCAACTTGATTTGCTGTTTGTCTCCAAGTTCTTTGAACACCACCCAATA
CCACAGGAAGAGGCGTCCTTAGCAGAGACTGCCCTAACATCTGGATCATCCCCTTCCGCA
CCCGCCTCGGACTCTATTGGGCCCCAAATTCTCACCAGTCCGTCTCCTTCAAAATCCATT
CCAATTCCACAGCCCTTCCGACCAGCAGATGAAGATCATCGAAATCAATTTGGGCAACGA
GACCGATCCTCATCAGCTCCCAATGTGCATATAAACACAATAGAACCTGTCAATATTGAT
GACTTGATTAGAGACCAAGGATTTCGTGGTGATGGAGGATCAACCACAGGTTTGTCTGCT
ACCCCCCCTGCCTCATTACCTGGCTCACTAACTAACGTGAAAGCCTTACAGAAATCTCCC
GGGCCTCAGCGAGAAAGGAAGTCATCTTCATCCTCAGAAGACAGGAATCGAATGAAAACA
CTTGGTAGACGGGACTCGAGTGATGATTGGGAGATTCCTGATGGGCAGATTACAGTGGGA
CAAAGAATTGGATCTGGATCATTTGGAACAGTCTACAAGGGAAAGTGGCATGGTGATGTG
GCAGTGAAAATGTTGAATGTGACAGCACCTACACCTCAGCAGTTACAAGCCTTCAAAAAT
GAAGTAGGAGTACTCAGGAAAACACGACATGTGAATATCCTACTCTTCATGGGCTATTCC
ACAAAGCCACAACTGGCTATTGTTACCCAGTGGTGTGAGGGCTCCAGCTTGTATCACCAT
CTCCATATCATTGAGACCAAATTTGAGATGATCAAGCTTATAGATATTGCACGACAGACT
GCACAGGGCATGGATTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAAT
AATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTG
AAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGGTCCATTTTGTGGATG
GCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATAT
GCATTTGGGATTGTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAAC
AACAGGGACCAGATAATTTTTATGGTGGGACGAGGATACCTGTCTCCAGATCTCAGTAAG
GTACGGAGTAACTGTCCAAAAGCCATGAAGAGATTAATGGCAGAGTGCCTCAAAAAGAAA
AGAGATGAGAGACCACTCTTTCCCCAAATTCTCGCCTCTATTGAGCTGCTGGCCCGCTCA
TTGCCAAAAATTCACCGCAGTGCATCAGAACCCTCCTTGAATCGGGCTGGTTTCCAAACA
GAGGATTTTAGTCTATATGCTTGTGCTTCTCCAAAAACACCCATCCAGGCAGGGGGATAT
GGTGCGTTTCCTGTCCACTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2362
Start on reference sequence 62
Mutations:
None
Discrepancy:
a1260c; a1263g;
 a1656g; a1845g;
 a1929g
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : BRAF
Symbol Nomenclature : BRAF
SYNONYM : B-RAF1; BRAF1; NS7; RAFB1
Designation : 94 kDa B-raf protein|B-Raf proto-oncogene serine/threonine-protein kinase (p94)|murine sarcoma viral (v-raf) oncogene homolog B1|proto-oncogene B-Raf|serine/threonine-protein kinase B-raf|v-raf murine sarcoma viral oncogene homolog B1
Full Nomenclature : v-raf murine sarcoma viral oncogene homolog B
GENEID : 673
HGNC : 1097
MIM : 164757
Vega : OTTHUMG00000157457
Target GenBank: NM_004333

 

Reference Sequence Alignment

  

HsCD00021530        ATGGCGGCGCTGAGCGGTGGCGGTGGTGGCGGCGCGGAGCCGGGCCAGGCTCTGTTCAAC
NM_004333.4         ATGGCGGCGCTGAGCGGTGGCGGTGGTGGCGGCGCGGAGCCGGGCCAGGCTCTGTTCAAC
XM_005250045.1      ATGGCGGCGCTGAGCGGTGGCGGTGGTGGCGGCGCGGAGCCGGGCCAGGCTCTGTTCAAC
XM_005250046.1      ATGGCGGCGCTGAGCGGTGGCGGTGGTGGCGGCGCGGAGCCGGGCCAGGCTCTGTTCAAC
                    ************************************************************

HsCD00021530        GGGGACATGGAGCCCGAGGCCGGCGCCGGCGCCGGCGCCGCGGCCTCTTCGGCTGCGGAC
NM_004333.4         GGGGACATGGAGCCCGAGGCCGGCGCCGGCGCCGGCGCCGCGGCCTCTTCGGCTGCGGAC
XM_005250045.1      GGGGACATGGAGCCCGAGGCCGGCGCCGGCGCCGGCGCCGCGGCCTCTTCGGCTGCGGAC
XM_005250046.1      GGGGACATGGAGCCCGAGGCCGGCGCCGGCGCCGGCGCCGCGGCCTCTTCGGCTGCGGAC
                    ************************************************************

HsCD00021530        CCTGCCATTCCGGAGGAGGTGTGGAATATCAAACAAATGATTAAGTTGACACAGGAACAT
NM_004333.4         CCTGCCATTCCGGAGGAGGTGTGGAATATCAAACAAATGATTAAGTTGACACAGGAACAT
XM_005250045.1      CCTGCCATTCCGGAGGAGGTGTGGAATATCAAACAAATGATTAAGTTGACACAGGAACAT
XM_005250046.1      CCTGCCATTCCGGAGGAGGTGTGGAATATCAAACAAATGATTAAGTTGACACAGGAACAT
                    ************************************************************

HsCD00021530        ATAGAGGCCCTATTGGACAAATTTGGTGGGGAGCATAATCCACCATCAATATATCTGGAG
NM_004333.4         ATAGAGGCCCTATTGGACAAATTTGGTGGGGAGCATAATCCACCATCAATATATCTGGAG
XM_005250045.1      ATAGAGGCCCTATTGGACAAATTTGGTGGGGAGCATAATCCACCATCAATATATCTGGAG
XM_005250046.1      ATAGAGGCCCTATTGGACAAATTTGGTGGGGAGCATAATCCACCATCAATATATCTGGAG
                    ************************************************************

HsCD00021530        GCCTATGAAGAATACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTG
NM_004333.4         GCCTATGAAGAATACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTG
XM_005250045.1      GCCTATGAAGAATACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTG
XM_005250046.1      GCCTATGAAGAATACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTG
                    ************************************************************

HsCD00021530        GAATCTCTGGGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTT
NM_004333.4         GAATCTCTGGGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTT
XM_005250045.1      GAATCTCTGGGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTT
XM_005250046.1      GAATCTCTGGGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTT
                    ************************************************************

HsCD00021530        ACATCTTCTTCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAAT
NM_004333.4         ACATCTTCTTCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAAT
XM_005250045.1      ACATCTTCTTCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAAT
XM_005250046.1      ACATCTTCTTCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAAT
                    ************************************************************

HsCD00021530        CCCACAGATGTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTC
NM_004333.4         CCCACAGATGTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTC
XM_005250045.1      CCCACAGATGTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTC
XM_005250046.1      CCCACAGATGTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTC
                    ************************************************************

HsCD00021530        CTGCCCAACAAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
NM_004333.4         CTGCCCAACAAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
XM_005250045.1      CTGCCCAACAAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
XM_005250046.1      CTGCCCAACAAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
                    ************************************************************

HsCD00021530        CTAAAGAAAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATT
NM_004333.4         CTAAAGAAAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATT
XM_005250045.1      CTAAAGAAAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATT
XM_005250046.1      CTAAAGAAAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATT
                    ************************************************************

HsCD00021530        CAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAA
NM_004333.4         CAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAA
XM_005250045.1      CAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAA
XM_005250046.1      CAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAA
                    ************************************************************

HsCD00021530        GAATTGCATGTGGAAGTGTTGGAGAATGTTCCACTTACAACACACAACTTTGTACGAAAA
NM_004333.4         GAATTGCATGTGGAAGTGTTGGAGAATGTTCCACTTACAACACACAACTTTGTACGAAAA
XM_005250045.1      GAATTGCATGTGGAAGTGTTGGAGAATGTTCCACTTACAACACACAACTTTGTACGAAAA
XM_005250046.1      GAATTGCATGTGGAAGTGTTGGAGAATGTTCCACTTACAACACACAACTTTGTACGAAAA
                    ************************************************************

HsCD00021530        ACGTTTTTCACCTTAGCATTTTGTGACTTTTGTCGAAAGCTGCTTTTCCAGGGTTTCCGC
NM_004333.4         ACGTTTTTCACCTTAGCATTTTGTGACTTTTGTCGAAAGCTGCTTTTCCAGGGTTTCCGC
XM_005250045.1      ACGTTTTTCACCTTAGCATTTTGTGACTTTTGTCGAAAGCTGCTTTTCCAGGGTTTCCGC
XM_005250046.1      ACGTTTTTCACCTTAGCATTTTGTGACTTTTGTCGAAAGCTGCTTTTCCAGGGTTTCCGC
                    ************************************************************

HsCD00021530        TGTCAAACATGTGGTTATAAATTTCACCAGCGTTGTAGTACAGAAGTTCCACTGATGTGT
NM_004333.4         TGTCAAACATGTGGTTATAAATTTCACCAGCGTTGTAGTACAGAAGTTCCACTGATGTGT
XM_005250045.1      TGTCAAACATGTGGTTATAAATTTCACCAGCGTTGTAGTACAGAAGTTCCACTGATGTGT
XM_005250046.1      TGTCAAACATGTGGTTATAAATTTCACCAGCGTTGTAGTACAGAAGTTCCACTGATGTGT
                    ************************************************************

HsCD00021530        GTTAATTATGACCAACTTGATTTGCTGTTTGTCTCCAAGTTCTTTGAACACCACCCAATA
NM_004333.4         GTTAATTATGACCAACTTGATTTGCTGTTTGTCTCCAAGTTCTTTGAACACCACCCAATA
XM_005250045.1      GTTAATTATGACCAACTTGATTTGCTGTTTGTCTCCAAGTTCTTTGAACACCACCCAATA
XM_005250046.1      GTTAATTATGACCAACTTGATTTGCTGTTTGTCTCCAAGTTCTTTGAACACCACCCAATA
                    ************************************************************

HsCD00021530        CCACAGGAAGAGGCGTCCTTAGCAGAGACTGCCCTAACATCTGGATCATCCCCTTCCGCA
NM_004333.4         CCACAGGAAGAGGCGTCCTTAGCAGAGACTGCCCTAACATCTGGATCATCCCCTTCCGCA
XM_005250045.1      CCACAGGAAGAGGCGTCCTTAGCAGAGACTGCCCTAACATCTGGATCATCCCCTTCCGCA
XM_005250046.1      CCACAGGAAGAGGCGTCCTTAGCAGAGACTGCCCTAACATCTGGATCATCCCCTTCCGCA
                    ************************************************************

HsCD00021530        CCCGCCTCGGACTCTATTGGGCCCCAAATTCTCACCAGTCCGTCTCCTTCAAAATCCATT
NM_004333.4         CCCGCCTCGGACTCTATTGGGCCCCAAATTCTCACCAGTCCGTCTCCTTCAAAATCCATT
XM_005250045.1      CCCGCCTCGGACTCTATTGGGCCCCAAATTCTCACCAGTCCGTCTCCTTCAAAATCCATT
XM_005250046.1      CCCGCCTCGGACTCTATTGGGCCCCAAATTCTCACCAGTCCGTCTCCTTCAAAATCCATT
                    ************************************************************

HsCD00021530        CCAATTCCACAGCCCTTCCGACCAGCAGATGAAGATCATCGAAATCAATTTGGGCAACGA
NM_004333.4         CCAATTCCACAGCCCTTCCGACCAGCAGATGAAGATCATCGAAATCAATTTGGGCAACGA
XM_005250045.1      CCAATTCCACAGCCCTTCCGACCAGCAGATGAAGATCATCGAAATCAATTTGGGCAACGA
XM_005250046.1      CCAATTCCACAGCCCTTCCGACCAGCAGATGAAGATCATCGAAATCAATTTGGGCAACGA
                    ************************************************************

HsCD00021530        GACCGATCCTCATCAGCTCCCAATGTGCATATAAACACAATAGAACCTGTCAATATTGAT
NM_004333.4         GACCGATCCTCATCAGCTCCCAATGTGCATATAAACACAATAGAACCTGTCAATATTGAT
XM_005250045.1      GACCGATCCTCATCAGCTCCCAATGTGCATATAAACACAATAGAACCTGTCAATATTGAT
XM_005250046.1      GACCGATCCTCATCAGCTCCCAATGTGCATATAAACACAATAGAACCTGTCAATATTGAT
                    ************************************************************

HsCD00021530        GACTTGATTAGAGACCAAGGATTTCGTGGTGATGGAGGATCAACCACAGGTTTGTCTGCT
NM_004333.4         GACTTGATTAGAGACCAAGGATTTCGTGGTGATGGAGGATCAACCACAGGTTTGTCTGCT
XM_005250045.1      GACTTGATTAGAGACCAAGGATTTCGTGGTGATGGAGGATCAACCACAGGTTTGTCTGCT
XM_005250046.1      GACTTGATTAGAGACCAAGGATTTCGTGGTGATGGAGGATCAACCACAGGTTTGTCTGCT
                    ************************************************************

HsCD00021530        ACCCCCCCTGCCTCATTACCTGGCTCACTAACTAACGTGAAAGCCTTACAGAAATCTCCC
NM_004333.4         ACCCCCCCTGCCTCATTACCTGGCTCACTAACTAACGTGAAAGCCTTACAGAAATCTCCA
XM_005250045.1      ACCCCCCCTGCCTCATTACCTGGCTCACTAACTAACGTGAAAGCCTTACAGAAATCTCCA
XM_005250046.1      ACCCCCCCTGCCTCATTACCTGGCTCACTAACTAACGTGAAAGCCTTACAGAAATCTCCA
                    ***********************************************************.

HsCD00021530        GGGCCTCAGCGAGAAAGGAAGTCATCTTCATCCTCAGAAGACAGGAATCGAATGAAAACA
NM_004333.4         GGACCTCAGCGAGAAAGGAAGTCATCTTCATCCTCAGAAGACAGGAATCGAATGAAAACA
XM_005250045.1      GGACCTCAGCGAGAAAGGAAGTCATCTTCATCCTCAGAAGACAGGAATCGAATGAAAACA
XM_005250046.1      GGACCTCAGCGAGAAAGGAAGTCATCTTCATCCTCAGAAGACAGGAATCGAATGAAAACA
                    **.*********************************************************

HsCD00021530        CTTGGTAGACGGGACTCGAGTGATGATTGGGAGATTCCTGATGGGCAGATTACAGTGGGA
NM_004333.4         CTTGGTAGACGGGACTCGAGTGATGATTGGGAGATTCCTGATGGGCAGATTACAGTGGGA
XM_005250045.1      CTTGGTAGACGGGACTCGAGTGATGATTGGGAGATTCCTGATGGGCAGATTACAGTGGGA
XM_005250046.1      CTTGGTAGACGGGACTCGAGTGATGATTGGGAGATTCCTGATGGGCAGATTACAGTGGGA
                    ************************************************************

HsCD00021530        CAAAGAATTGGATCTGGATCATTTGGAACAGTCTACAAGGGAAAGTGGCATGGTGATGTG
NM_004333.4         CAAAGAATTGGATCTGGATCATTTGGAACAGTCTACAAGGGAAAGTGGCATGGTGATGTG
XM_005250045.1      CAAAGAATTGGATCTGGATCATTTGGAACAGTCTACAAGGGAAAGTGGCATGGTGATGTG
XM_005250046.1      CAAAGAATTGGATCTGGATCATTTGGAACAGTCTACAAGGGAAAGTGGCATGGTGATGTG
                    ************************************************************

HsCD00021530        GCAGTGAAAATGTTGAATGTGACAGCACCTACACCTCAGCAGTTACAAGCCTTCAAAAAT
NM_004333.4         GCAGTGAAAATGTTGAATGTGACAGCACCTACACCTCAGCAGTTACAAGCCTTCAAAAAT
XM_005250045.1      GCAGTGAAAATGTTGAATGTGACAGCACCTACACCTCAGCAGTTACAAGCCTTCAAAAAT
XM_005250046.1      GCAGTGAAAATGTTGAATGTGACAGCACCTACACCTCAGCAGTTACAAGCCTTCAAAAAT
                    ************************************************************

HsCD00021530        GAAGTAGGAGTACTCAGGAAAACACGACATGTGAATATCCTACTCTTCATGGGCTATTCC
NM_004333.4         GAAGTAGGAGTACTCAGGAAAACACGACATGTGAATATCCTACTCTTCATGGGCTATTCC
XM_005250045.1      GAAGTAGGAGTACTCAGGAAAACACGACATGTGAATATCCTACTCTTCATGGGCTATTCC
XM_005250046.1      GAAGTAGGAGTACTCAGGAAAACACGACATGTGAATATCCTACTCTTCATGGGCTATTCC
                    ************************************************************

HsCD00021530        ACAAAGCCACAACTGGCTATTGTTACCCAGTGGTGTGAGGGCTCCAGCTTGTATCACCAT
NM_004333.4         ACAAAGCCACAACTGGCTATTGTTACCCAGTGGTGTGAGGGCTCCAGCTTGTATCACCAT
XM_005250045.1      ACAAAGCCACAACTGGCTATTGTTACCCAGTGGTGTGAGGGCTCCAGCTTGTATCACCAT
XM_005250046.1      ACAAAGCCACAACTGGCTATTGTTACCCAGTGGTGTGAGGGCTCCAGCTTGTATCACCAT
                    ************************************************************

HsCD00021530        CTCCATATCATTGAGACCAAATTTGAGATGATCAAGCTTATAGATATTGCACGACAGACT
NM_004333.4         CTCCATATCATTGAGACCAAATTTGAGATGATCAAACTTATAGATATTGCACGACAGACT
XM_005250045.1      CTCCATATCATTGAGACCAAATTTGAGATGATCAAACTTATAGATATTGCACGACAGACT
XM_005250046.1      CTCCATATCATTGAGACCAAATTTGAGATGATCAAACTTATAGATATTGCACGACAGACT
                    ***********************************.************************

HsCD00021530        GCACAGGGCATGGATTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAAT
NM_004333.4         GCACAGGGCATGGATTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAAT
XM_005250045.1      GCACAGGGCATGGATTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAAT
XM_005250046.1      GCACAGGGCATGGATTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAAT
                    ************************************************************

HsCD00021530        AATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTG
NM_004333.4         AATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTG
XM_005250045.1      AATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTG
XM_005250046.1      AATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTG
                    ************************************************************

HsCD00021530        AAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGGTCCATTTTGTGGATG
NM_004333.4         AAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATG
XM_005250045.1      AAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATG
XM_005250046.1      AAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATG
                    ********************************************.***************

HsCD00021530        GCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATAT
NM_004333.4         GCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATAT
XM_005250045.1      GCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATAT
XM_005250046.1      GCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATAT
                    ************************************************************

HsCD00021530        GCATTTGGGATTGTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAAC
NM_004333.4         GCATTTGGAATTGTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAAC
XM_005250045.1      GCATTTGGAATTGTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAAC
XM_005250046.1      GCATTTGGAATTGTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAAC
                    ********.***************************************************

HsCD00021530        AACAGGGACCAGATAATTTTTATGGTGGGACGAGGATACCTGTCTCCAGATCTCAGTAAG
NM_004333.4         AACAGGGACCAGATAATTTTTATGGTGGGACGAGGATACCTGTCTCCAGATCTCAGTAAG
XM_005250045.1      AACAGGGACCAGATAATTTTTATGGTGGGACGAGGATACCTGTCTCCAGATCTCAGTAAG
XM_005250046.1      AACAGGGACCAGATAATTTTTATGGTGGGACGAGGATACCTGTCTCCAGATCTCAGTAAG
                    ************************************************************

HsCD00021530        GTACGGAGTAACTGTCCAAAAGCCATGAAGAGATTAATGGCAGAGTGCCTCAAAAAGAAA
NM_004333.4         GTACGGAGTAACTGTCCAAAAGCCATGAAGAGATTAATGGCAGAGTGCCTCAAAAAGAAA
XM_005250045.1      GTACGGAGTAACTGTCCAAAAGCCATGAAGAGATTAATGGCAGAGTGCCTCAAAAAGAAA
XM_005250046.1      GTACGGAGTAACTGTCCAAAAGCCATGAAGAGATTAATGGCAGAGTGCCTCAAAAAGAAA
                    ************************************************************

HsCD00021530        AGAGATGAGAGACCACTCTTTCCCCAAATTCTCGCCTCTATTGAGCTGCTGGCCCGCTCA
NM_004333.4         AGAGATGAGAGACCACTCTTTCCCCAAATTCTCGCCTCTATTGAGCTGCTGGCCCGCTCA
XM_005250045.1      AGAGATGAGAGACCACTCTTTCCCCAAATTCTCGCCTCTATTGAGCTGCTGGCCCGCTCA
XM_005250046.1      AGAGATGAGAGACCACTCTTTCCCCAAGAGAATTTGCAGCCTTCAAG-------------
                    ***************************.: .:     . . * ...              

HsCD00021530        TTGCCAAAAATTCACCGCAGTGCATCAGAACCCTCCTTGAATCGGGCTGGTTTCCAAACA
NM_004333.4         TTGCCAAAAATTCACCGCAGTGCATCAGAACCCTCCTTGAATCGGGCTGGTTTCCAAACA
XM_005250045.1      TTGCCAAAAATTCACCGCAGTGCATCAGAACCCTCCTTGAATCGGGCTGGTTTCCAAACA
XM_005250046.1      ------TAGCCACCATCATGGCAGCATCTGCTCTTATTTCTTAAGTCTTGTGTTCGTACA
                          :*.. :*..  .:*  .. .: :.* ** .** .:*..* ** ** * *.:***

HsCD00021530        GAGGATTTTAGTCTATATGCTTGTGCTTCTCCAAAAACACCCATCCAGGCAGGGGGATAT
NM_004333.4         GAGGATTTTAGTCTATATGCTTGTGCTTCTCCAAAAACACCCATCCAGGCAGGGGGATAT
XM_005250045.1      GAGGATTTTAGTCTATATGCTTGTGCTTCTCCAAAAACACCCATCCAGGCAGGGGGATAT
XM_005250046.1      ATTTGTTAACATCAAAACACAGTTCTGTTCCTCAAATCTTTTTTTAAAGATACAAAATTT
                    .:  .**::..**:*:* .*:  *   *  * .***:*:   :* .*.*.:. ...**:*

HsCD00021530        GGTGCGTTTCCTGTCCACTAG---
NM_004333.4         GGTGCGTTTCCTGTCCACTGA---
XM_005250045.1      GGAGAATTTGCAGCCTTCAAGTAG
XM_005250046.1      CCAATGCATAAGCTGA--------
                      :. . :* .             

Pathways

NCI : CDC42 signaling events
NCI : Downstream signaling in naïve CD8+ T cells
NCI : ErbB1 downstream signaling
NCI : PDGFR-beta signaling pathway
NCI : Ras signaling in the CD4+ TCR pathway
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by focal adhesion kinase
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : mTOR signaling pathway
Panther : Angiogenesis
Panther : Integrin signalling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Reactome : ARMS-mediated activation
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Disease
Reactome : Frs2-mediated activation
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Post NMDA receptor activation events
Reactome : Prolonged ERK activation events
Reactome : Signal Transduction
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to p38 via RIT and RIN
Reactome : Spry regulation of FGF signaling
Reactome : Transmission across Chemical Synapses
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Estrogen signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Senescence and Autophagy
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : Serotonin Receptor 4/6/7 and NR3C Signaling
WikiPathway : TSH signaling pathway

Clone

Cloning Information : 203960
HIP Master Clone ID : 178310
Original Clone ID : FLH203960.01X

Organism


TAX_ID : 9606
Species Specific ID: 673

Genome

Chromosome : 7
Map Location : 7q34
Ensembl : ENSG00000157764

Reagents

Labome : B-Raf-antibody