DNASU Plasmid Repository • 480.965.5697 | Email

CREB1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CREB1
Gene Name:  cAMP responsive element binding protein 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH010198.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00021918

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1026nts         Open reading frame : 1 to 1026
Reference Sequence Alignment

ATGACCATGGAATCTGGAGCCGAGAACCAGCAGAGTGGAGATGCAGCTGTAACAGAAGCT
GAAAACCAACAAATGACAGTTCAAGCCCAGCCACAGATTGCCACATTAGCCCAGGTATCT
ATGCCAGCAGCTCATGCAACATCATCTGCTCCCACCGTAACTCTAGTACAGCTGCCCAAT
GGGCAGACAGTTCAAGTCCATGGAGTCATTCAGGCGGCCCAGCCATCAGTTATTCAGTCT
CCACAAGTCCAAACAGTTCAGTCTTCCTGTAAGGACTTAAAAAGACTTTTCTCCGGAACA
CAGATTTCAACTATTGCAGAAAGTGAAGATTCACAGGAGTCAGTGGATAGTGTAACTGAT
TCCCAAAAGCGAAGGGAAATTCTTTCAAGGAGGCCTTCCTACAGGAAAATTTTGAATGAC
TTATCTTCTGATGCACCAGGAGTGCCAAGGATTGAAGAAGAGAAGTCTGAAGAGGAGACT
TCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTACCAAACTAGCAGTGGA
CAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGG
GTACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACC
ATTCTACAGTATGCACAGACCACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTT
GTTGTTCAAGCTGCCTCTGGAGACGTACAAACATACCAGATTCGCACAGCACCCACTAGC
ACTATTGCCCCTGGAGTTGTTATGGCATCCTCCCCAGCACTTCCTACACAGCCTGCTGAA
GAAGCAGCACGAAAGAGAGAGGTCCGTCTAATGAAGAACAGGGAAGCAGCTCGAGAGTGT
CGTAGAAAGAAGAAAGAATATGTGAAATGTTTAGAAAACAGAGTGGCAGTGCTTGAAAAT
CAAAACAAGACATTGATTGAGGAGCTAAAAGCACTTAAGGACCTTTACTGCCACAAATCA
GATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1100
Start on reference sequence 117
Mutations:
None
Discrepancy:
ins@258,42;
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CREB1
Symbol Nomenclature : CREB1
SYNONYM : CREB
Designation : CREB-1|active transcription factor CREB|cAMP-response element-binding protein-1|cAMP-responsive element-binding protein 1|cyclic AMP-responsive element-binding protein 1|transactivator protein
Full Nomenclature : cAMP responsive element binding protein 1
GENEID : 1385
GI : 61358854
GenBank Accession : AY888688
HGNC : 2345
MIM : 123810
Vega : OTTHUMG00000132936
Target GenBank: NM_004379

 

Reference Sequence Alignment

  

HsCD00021918      ATGACCATGGAATCTGGAGCCGAGAACCAGCAGAGTGGAGATGCAGCTGTAACAGAAGCT
NM_004379.3       ATGACCATGGAATCTGGAGCCGAGAACCAGCAGAGTGGAGATGCAGCTGTAACAGAAGCT
NM_134442.3       ATGACCATGGAATCTGGAGCCGAGAACCAGCAGAGTGGAGATGCAGCTGTAACAGAAGCT
                  ************************************************************

HsCD00021918      GAAAACCAACAAATGACAGTTCAAGCCCAGCCACAGATTGCCACATTAGCCCAGGTATCT
NM_004379.3       GAAAACCAACAAATGACAGTTCAAGCCCAGCCACAGATTGCCACATTAGCCCAGGTATCT
NM_134442.3       GAAAACCAACAAATGACAGTTCAAGCCCAGCCACAGATTGCCACATTAGCCCAGGTATCT
                  ************************************************************

HsCD00021918      ATGCCAGCAGCTCATGCAACATCATCTGCTCCCACCGTAACTCTAGTACAGCTGCCCAAT
NM_004379.3       ATGCCAGCAGCTCATGCAACATCATCTGCTCCCACCGTAACTCTAGTACAGCTGCCCAAT
NM_134442.3       ATGCCAGCAGCTCATGCAACATCATCTGCTCCCACCGTAACTCTAGTACAGCTGCCCAAT
                  ************************************************************

HsCD00021918      GGGCAGACAGTTCAAGTCCATGGAGTCATTCAGGCGGCCCAGCCATCAGTTATTCAGTCT
NM_004379.3       GGGCAGACAGTTCAAGTCCATGGAGTCATTCAGGCGGCCCAGCCATCAGTTATTCAGTCT
NM_134442.3       GGGCAGACAGTTCAAGTCCATGGAGTCATTCAGGCGGCCCAGCCATCAGTTATTCAGTCT
                  ************************************************************

HsCD00021918      CCACAAGTCCAAACAGTTCAGTCTTCCTGTAAGGACTTAAAAAGACTTTTCTCCGGAACA
NM_004379.3       CCACAAGTCCAAACAGTTCAG---------------------------------------
NM_134442.3       CCACAAGTCCAAACAGTTCAGTCTTCCTGTAAGGACTTAAAAAGACTTTTCTCCGGAACA
                  *********************                                       

HsCD00021918      CAGATTTCAACTATTGCAGAAAGTGAAGATTCACAGGAGTCAGTGGATAGTGTAACTGAT
NM_004379.3       ---ATTTCAACTATTGCAGAAAGTGAAGATTCACAGGAGTCAGTGGATAGTGTAACTGAT
NM_134442.3       CAGATTTCAACTATTGCAGAAAGTGAAGATTCACAGGAGTCAGTGGATAGTGTAACTGAT
                     *********************************************************

HsCD00021918      TCCCAAAAGCGAAGGGAAATTCTTTCAAGGAGGCCTTCCTACAGGAAAATTTTGAATGAC
NM_004379.3       TCCCAAAAGCGAAGGGAAATTCTTTCAAGGAGGCCTTCCTACAGGAAAATTTTGAATGAC
NM_134442.3       TCCCAAAAGCGAAGGGAAATTCTTTCAAGGAGGCCTTCCTACAGGAAAATTTTGAATGAC
                  ************************************************************

HsCD00021918      TTATCTTCTGATGCACCAGGAGTGCCAAGGATTGAAGAAGAGAAGTCTGAAGAGGAGACT
NM_004379.3       TTATCTTCTGATGCACCAGGAGTGCCAAGGATTGAAGAAGAGAAGTCTGAAGAGGAGACT
NM_134442.3       TTATCTTCTGATGCACCAGGAGTGCCAAGGATTGAAGAAGAGAAGTCTGAAGAGGAGACT
                  ************************************************************

HsCD00021918      TCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTACCAAACTAGCAGTGGA
NM_004379.3       TCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTACCAAACTAGCAGTGGA
NM_134442.3       TCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTACCAAACTAGCAGTGGA
                  ************************************************************

HsCD00021918      CAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGG
NM_004379.3       CAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGG
NM_134442.3       CAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGG
                  ************************************************************

HsCD00021918      GTACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACC
NM_004379.3       GTACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACC
NM_134442.3       GTACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACC
                  ************************************************************

HsCD00021918      ATTCTACAGTATGCACAGACCACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTT
NM_004379.3       ATTCTACAGTATGCACAGACCACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTT
NM_134442.3       ATTCTACAGTATGCACAGACCACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTT
                  ************************************************************

HsCD00021918      GTTGTTCAAGCTGCCTCTGGAGACGTACAAACATACCAGATTCGCACAGCACCCACTAGC
NM_004379.3       GTTGTTCAAGCTGCCTCTGGAGACGTACAAACATACCAGATTCGCACAGCACCCACTAGC
NM_134442.3       GTTGTTCAAGCTGCCTCTGGAGACGTACAAACATACCAGATTCGCACAGCACCCACTAGC
                  ************************************************************

HsCD00021918      ACTATTGCCCCTGGAGTTGTTATGGCATCCTCCCCAGCACTTCCTACACAGCCTGCTGAA
NM_004379.3       ACTATTGCCCCTGGAGTTGTTATGGCATCCTCCCCAGCACTTCCTACACAGCCTGCTGAA
NM_134442.3       ACTATTGCCCCTGGAGTTGTTATGGCATCCTCCCCAGCACTTCCTACACAGCCTGCTGAA
                  ************************************************************

HsCD00021918      GAAGCAGCACGAAAGAGAGAGGTCCGTCTAATGAAGAACAGGGAAGCAGCTCGAGAGTGT
NM_004379.3       GAAGCAGCACGAAAGAGAGAGGTCCGTCTAATGAAGAACAGGGAAGCAGCTCGAGAGTGT
NM_134442.3       GAAGCAGCACGAAAGAGAGAGGTCCGTCTAATGAAGAACAGGGAAGCAGCTCGAGAGTGT
                  ************************************************************

HsCD00021918      CGTAGAAAGAAGAAAGAATATGTGAAATGTTTAGAAAACAGAGTGGCAGTGCTTGAAAAT
NM_004379.3       CGTAGAAAGAAGAAAGAATATGTGAAATGTTTAGAAAACAGAGTGGCAGTGCTTGAAAAT
NM_134442.3       CGTAGAAAGAAGAAAGAATATGTGAAATGTTTAGAAAACAGAGTGGCAGTGCTTGAAAAT
                  ************************************************************

HsCD00021918      CAAAACAAGACATTGATTGAGGAGCTAAAAGCACTTAAGGACCTTTACTGCCACAAATCA
NM_004379.3       CAAAACAAGACATTGATTGAGGAGCTAAAAGCACTTAAGGACCTTTACTGCCACAAATCA
NM_134442.3       CAAAACAAGACATTGATTGAGGAGCTAAAAGCACTTAAGGACCTTTACTGCCACAAATCA
                  ************************************************************

HsCD00021918      GATTAG
NM_004379.3       GATTAA
NM_134442.3       GATTAA
                  *****.

Pathways

NCI : AP-1 transcription factor network
NCI : ATF-2 transcription factor network
NCI : ErbB1 downstream signaling
NCI : FOXA2 and FOXA3 transcription factor networks
NCI : Glucocorticoid receptor regulatory network
NCI : HIF-1-alpha transcription factor network
NCI : Integrin-linked kinase signaling
NCI : LKB1 signaling events
NCI : LPA4-mediated signaling events
NCI : Nongenotropic Androgen signaling
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : Signaling mediated by p38-alpha and p38-beta
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : VEGFR3 signaling in lymphatic endothelium
NCI : Validated targets of C-MYC transcriptional repression
NCI : p38 signaling mediated by MAPKAP kinases
Panther : Enkephalin release
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Reactome : AKT phosphorylates targets in the nucleus
Reactome : Activated TLR4 signalling
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : CREB phosphorylation
Reactome : CREB phosphorylation through the activation of Adenylate Cyclase
Reactome : CREB phosphorylation through the activation of CaMKII
Reactome : CREB phosphorylation through the activation of CaMKK
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Ca-dependent events
Reactome : CaM pathway
Reactome : CaMK IV-mediated phosphorylation of CREB
Reactome : Calmodulin induced events
Reactome : Circadian Clock
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAG and IP3 signaling
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : G-protein mediated events
Reactome : GAB1 signalosome
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : Mitochondrial biogenesis
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : NOTCH2 intracellular domain regulates transcription
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Opioid Signalling
Reactome : Organelle biogenesis and maintenance
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : PKA-mediated phosphorylation of CREB
Reactome : PLC beta mediated events
Reactome : PLC-gamma1 signalling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Post NMDA receptor activation events
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH2
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : Transcriptional activation of mitochondrial biogenesis
Reactome : Transmission across Chemical Synapses
WikiPathway : Adipogenesis
WikiPathway : Androgen receptor signaling pathway
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : DNA damage response
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Energy Metabolism
WikiPathway : Estrogen signaling pathway
WikiPathway : FSH signaling pathway
WikiPathway : G1 to S cell cycle control
WikiPathway : Hypothetical Network for Drug Addiction
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Leptin signaling pathway
WikiPathway : Mitochondrial Gene Expression
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : SIDS Susceptibility Pathways
WikiPathway : SREBP signalling
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : Serotonin Receptor 4/6/7 and NR3C Signaling
WikiPathway : TCR Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR
WikiPathway : p38 MAPK Signaling Pathway

Protein

SMART domain : BRLZ : basic region leucin zipper
UniProt : P16220
UniProt : Q5U0J5
UniProt : Q53X93
HPRD : 00442

Clone

Cloning Information : 10198
HIP Master Clone ID : 14260
Original Clone ID : FLH010198.01X

Organism


TAX_ID : 9606
Species Specific ID: 1385

Genome

Chromosome : 2
Map Location : 2q34
Ensembl : ENSG00000118260

Reagents

Labome : CREB-antibody