DNASU Plasmid Repository • 480.965.5697 | Email

LAMA4 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  LAMA4
Gene Name:  laminin, alpha 4
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH023705.01X
Keyword: potential short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: Short variant or partial clone comparing to NM_002290
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00022187

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 363nts         Open reading frame : 1 to 363
Reference Sequence Alignment

ATGGCTTTGAGCTCAGCCTGGCGCTCGGTTCTGCCTCTGTGGCTCCTCTGGAGCGCTGCC
TGCTCCCGCGCCGCGTCCGGGGACGACAACGCTTTTCCTTTTGACATTGAAGGGAGCTCA
GCGGTTGGCAGGCAAGACCCGCCTGAGACGAGCGAACCCCGCGTGGCTCTGGGACGCCTG
CCGCCTGCGGCCGAGGTACAGTGTCCCTGCCATTGCCACCCTGCTGGGGCACCTGCGCCC
CCGCGGGCTGTGCCACACTCGTCCTTCTCTCTCTCTCCGCCTCTTTCCTCTCCCCAGTGC
CTTGAGAGTTTCACCTGGGCTAGGTCAGTTCGGAAACTTGAAATAAAGAGTTTTCCTTTG
TAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 592
Start on reference sequence 230
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : LAMA4
Symbol Nomenclature : LAMA4
SYNONYM : CMD1JJ; LAMA3; LAMA4*-1
Designation : laminin alpha 4 chain|laminin subunit alpha-4
Full Nomenclature : laminin, alpha 4
GENEID : 3910
Locus Tag : RP1-142L7.4
HGNC : 6484
MIM : 600133
Vega : OTTHUMG00000015386
Target GenBank: BC004241

 

Reference Sequence Alignment

  

HsCD00022187        ATGGCTTTGAGCTCAGCCTGGCGCTCGGTTCTGCCTCTGTGGCTCCTCTGGAGCGCTGCC
NM_001105208.2      ATGGCTTTGAGCTCAGCCTGGCGCTCGGTTCTGCCTCTGTGGCTCCTCTGGAGCGCTGCC
NM_001105209.2      ATGGCTTTGAGCTCAGCCTGGCGCTCGGTTCTGCCTCTGTGGCTCCTCTGGAGCGCTGCC
                    ************************************************************

HsCD00022187        TGCTCCCGCGCCGCGTCCGGGGACGACAACGCTTTTCCTTTTGACATTGAAGGGAGCTCA
NM_001105208.2      TGCTCCCGCGCCGCGTCCGGGGACGACAACGCTTTTCCTTTTGACATTGAAGGGAGCTCA
NM_001105209.2      TGCTCCCGCGCCGCGTCCGGGGACGACAACGCTTTTCCTTTTGACATTGAAGGGAGCTCA
                    ************************************************************

HsCD00022187        GCGGTTGGCAGGCAAGACCCGCCTGAGACGAGCGAACCCCGCGTGGCTCTGGGACGCCTG
NM_001105208.2      GCGGTTGGCAGGCAAGACCCGCCTGAGACGAGCGAACCCCGCGTGGCTCTGGGACGCCTG
NM_001105209.2      GCGGTTGGCAGGCAAGACCCGCCTGAGACGAGCGAACCCCGCGTGGCTCTGGGACGCCTG
                    ************************************************************

HsCD00022187        CCGCCTGCGGCCGAGGTACAGTGTCCCTGCCATTGCCACCCTGCTGGGGCACCTGCGCCC
NM_001105208.2      CCGCCTGCGGCCGAGGTACAGTGTCCCTGCCATTGCCACCCTGCTGGGGCACCTGCGCCC
NM_001105209.2      CCGCCTGCGGCCGAGGTACAGTGTCCCTGCCATTGCCACCCTGCTGGGGCACCTGCGCCC
                    ************************************************************

HsCD00022187        CCGCGGGCTGTGCCACACTCGTCCTTCTCTCTCTCTCCGCCTCTTTCCTCTCCCCAGTGC
NM_001105208.2      CCGCGGGCTGTGCCACACTCGTCCTTCTCTCTCTCTCCGCCTCTTTCCTCTCCCCAGTGC
NM_001105209.2      CCGCGGGCTGTGCCACACTCGTCCTTCTCTCTCTCTCCGCCTCTTTCCTCTCCCCAGTGC
                    ************************************************************

HsCD00022187        CTTGAGAGTTTCACCTGGGCTAGGTCAGTTCGGAAACTTGAAATAAAGAGTTTTCCTTTG
NM_001105208.2      CTTGAGAGTTTCACCTGGGCTAGGTCAGTTCGGAAACTTGAAATAAAGAGTTTTCCTTTG
NM_001105209.2      CTTGAGAGTTTCACCTGGGCTAGGTCAGTTCGGAAACTTGAAATAAAGAGTTTTCCTTTG
                    ************************************************************

HsCD00022187        TAG
NM_001105208.2      TAA
NM_001105209.2      TAA
                    **.

Pathways

NCI : Beta1 integrin cell surface interactions
NCI : Beta3 integrin cell surface interactions
NCI : FOXM1 transcription factor network
NCI : a6b1 and a6b4 Integrin signaling
Panther : Integrin signalling pathway
Reactome : ECM proteoglycans
Reactome : Extracellular matrix organization
Reactome : Laminin interactions
Reactome : Non-integrin membrane-ECM interactions
WikiPathway : Focal Adhesion

Protein

UniProt : Q5D044
UniProt : Q16363
HPRD : 02532

Clone

Cloning Information : 23705
HIP Master Clone ID : 54081
Original Clone ID : FLH023705.01X

Organism


TAX_ID : 9606
Species Specific ID: 3910

Genome

Chromosome : 6
Map Location : 6q21
Ensembl : ENSG00000112769

Reagents

Labome : LAMA4-antibody