DNASU Plasmid Repository • 480.965.5697 | Email

PIK3C3 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3C3
Gene Name:  phosphatidylinositol 3-kinase, catalytic subunit type 3
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH147911.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00022338

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2664nts         Open reading frame : 1 to 2664
Reference Sequence Alignment

ATGGGGGAAGCAGAGAAGTTTCACTACATCTATAGTTGTGACCTGGATATCAACGTCCAG
CTTAAGATAGGAAGCTTGGAAGGGAAGAGAGAACAAAAGAGTTATAAAGCTGTCCTGGAA
GACCCAATGTTGAAGTTCTCAGGACTATATCAAGAGACATGCTCTGATCTTTATGTTACT
TGTCAAGTTTTTGCAGAAGGGAAGCCTTTGGCCTTGCCAGTGAGAACATCCTACAAAGCA
TTTAGTACAAGATGGAACTGGAATGAATGGCTGAAACTACCAGTAAAATACCCTGACCTG
CCCAGGAATGCCCAAGTGGCCCTCACCATATGGGATGTGTATGGTCCCGGAAAAGCAGTG
CCTGTAGGAGGAACAACGGTTTCGCTCTTTGGAAAATACGGCATGTTTCGCCAAGGGATG
CATGACTTGAAAGTCTGGCCTAATGTAGAAGCAGATGGATCAGAACCCACAAAAACTCCT
GGCAGAACAAGTAGCACTCTCTCAGAAGATCAGATGAGCCGTCTTGCCAAGCTCACCAAA
GCTCATCGACAAGGACACATGGTGAAAGTAGATTGGCTGGATAGATTGACATTTAGAGAA
ATAGAAATGATAAATGAGAGTGAAAAACGAAGTTCTAATTTCATGTACCTGATGGTTGAA
TTTCGATGTGTCAAGTGTGATGATAAGGAATATGGTATTGTTTATTATGAAAAGGACGGT
GATGAATCATCTCCAATTTTAACAAGTTTTGAATTAGTGAAAGTTCCTGACCCCCAGATG
TCTATGGAGAATTTAGTTGAGAGCAAACACCACAAGCTTGCCCGGAGTTTAAGAAGTGGA
CCTTCTGACCACGATCTGAAACCCAATGCTGCCACGAGAGATCAGTTAAATATTATTGTG
AGTTATCCACCAACCAAGCAACTTACATATGAAGAACAAGATCTTGTTTGGAAGTTTAGA
TATTATCTTACGAATCAAGAAAAAGCCTTGACAAAATTCTTGAAATGTGTTAATTGGGAT
CTACCTCAAGAGGCCAAACAGGCCTTGGAACTTCTGGGAAAATGGAAGCCGATGGATGTA
GAGGACTCCTTGGAGCTGTTATCCTCTCATTACACCAACCCAACTGTGAGGCGTTATGCT
GTTGCCCGGTTGCGACAGGCCGATGATGAGGATTTGTTGATGTACCTATTACAATTGGTC
CAGGCTCTCAAATATGAAAATTTTGATGATATAAAGAATGGATTGGAACCTACCAAGAAG
GATAGTCAGAGTTCAGTGTCAGAAAATGTGTCAAATTCTGGAATAAATTCTGCAGAAATA
GATAGCTCCCAAATTATAACCAGCCCCCTTCCTTCAGTCTCTTCACCTCCTCCTGCATCA
AAAACAAAAGAAGTTCCAGATGGCGAAAATCTGGAACAAGATCTCTGTACCTTCTTGATA
TCGAGAGCCTGCAAAAACTCAACACTGGCTAATTATTTATACTGGTATGTGATAGTGGAA
TGTGAAGATCAAGATACTCAGCAGAGAGATCCAAAGACCCATGAGATGTACTTGAACGTA
ATGAGAAGATTCAGCCAAGCATTGTTGAAGGGTGATAAGTCTGTCAGAGTTATGCGTTCT
TTGCTGGCTGCACAACAGACATTTGTAGATCGGTTGGTGCATCTAATGAAGGCAGTACAA
CGCGAAAGTGGAAATCGTAAGAAAAAGAATGAGAGACTACAGGCATTGCTTGGAGATAAT
GAAAAGATGAATTTGTCAGATGTGGAACTTATCCCGTTGCCTTTAGAACCCCAAGTGAAA
ATTAGAGGAATAATTCCGGAAACAGCTACACTGTTTAAAAGTGCCCTTATGCCTGCACAG
TTGTTTTTTAAGACGGAAGATGGAGGCAAATATCCAGTTATATTTAAGCATGGAGATGAT
TTACGTCAAGATCAACTTATTCTTCAAATCATTTCACTCATGGACAAGCTGTTACGGAAA
GAAAATCTGGACTTGAAATTGACACCTTATAAGGTGTTAGCCACCAGTACAAAACATGGC
TTCATGCAGTTTATCCAGTCAGTTCCTGTGGCTGAAGTTCTTGATACAGAGGGAAGCATT
CAGAACTTTTTTAGAAAATATGCACCAAGTGAGAATGGGCCAAATGGGATTAGTGCTGAG
GTCATGGACACTTACGTTAAAAGCTGTGCTGGATATTGCGTGATCACCTATATACTTGGA
GTTGGAGACAGGCACCTGGATAACCTTTTGCTAACAAAAACAGGCAAACTCTTCCACATA
GACTTTGGATATATTTTGGGTCGGGATCCAAAGCCTCTTCCTCCACCAATGAAGCTGAAT
AAAGAAATGGTAGAAGGAATGGGGGGCACACAGAGTGAGCAGTACCAAGAGTTCCGTAAA
CAGTGTTACACGGCTTTCCTCCACCTGCGAAGGTATTCTAATCTGATTTTGAACTTGTTT
TCCTTGATGGTTGATGCAAACATTCCAGATATTGCACTTGAACCAGATAAAACTGTGAAA
AAGGTTCAGGATAAATTCCGCTTAGACCTGTCGGATGAAGAGGCTGTGCATTACATGCAG
AGTCTGATTGATGAGAGTGTCCATGCTCTTTTTGCTGCAGTGGTGGAACAGATTCACAAG
TTTGCCCAGTACTGGAGAAAATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2722
Start on reference sequence 59
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3C3
Symbol Nomenclature : PIK3C3
SYNONYM : VPS34; hVps34
Designation : PI3-kinase type 3|PI3K type 3|PtdIns-3-kinase type 3|phosphatidylinositol 3-kinase catalytic subunit type 3|phosphatidylinositol 3-kinase p100 subunit|phosphoinositide-3-kinase, class 3
Full Nomenclature : phosphatidylinositol 3-kinase, catalytic subunit type 3
GENEID : 5289
GI : 61369056
GenBank Accession : AY891351
HGNC : 8974
MIM : 602609
Target GenBank: NM_002647

 

Reference Sequence Alignment

  

HsCD00022338      ATGGGGGAAGCAGAGAAGTTTCACTACATCTATAGTTGTGACCTGGATATCAACGTCCAG
NM_002647.2       ATGGGGGAAGCAGAGAAGTTTCACTACATCTATAGTTGTGACCTGGATATCAACGTCCAG
                  ************************************************************

HsCD00022338      CTTAAGATAGGAAGCTTGGAAGGGAAGAGAGAACAAAAGAGTTATAAAGCTGTCCTGGAA
NM_002647.2       CTTAAGATAGGAAGCTTGGAAGGGAAGAGAGAACAAAAGAGTTATAAAGCTGTCCTGGAA
                  ************************************************************

HsCD00022338      GACCCAATGTTGAAGTTCTCAGGACTATATCAAGAGACATGCTCTGATCTTTATGTTACT
NM_002647.2       GACCCAATGTTGAAGTTCTCAGGACTATATCAAGAGACATGCTCTGATCTTTATGTTACT
                  ************************************************************

HsCD00022338      TGTCAAGTTTTTGCAGAAGGGAAGCCTTTGGCCTTGCCAGTGAGAACATCCTACAAAGCA
NM_002647.2       TGTCAAGTTTTTGCAGAAGGGAAGCCTTTGGCCTTGCCAGTGAGAACATCCTACAAAGCA
                  ************************************************************

HsCD00022338      TTTAGTACAAGATGGAACTGGAATGAATGGCTGAAACTACCAGTAAAATACCCTGACCTG
NM_002647.2       TTTAGTACAAGATGGAACTGGAATGAATGGCTGAAACTACCAGTAAAATACCCTGACCTG
                  ************************************************************

HsCD00022338      CCCAGGAATGCCCAAGTGGCCCTCACCATATGGGATGTGTATGGTCCCGGAAAAGCAGTG
NM_002647.2       CCCAGGAATGCCCAAGTGGCCCTCACCATATGGGATGTGTATGGTCCCGGAAAAGCAGTG
                  ************************************************************

HsCD00022338      CCTGTAGGAGGAACAACGGTTTCGCTCTTTGGAAAATACGGCATGTTTCGCCAAGGGATG
NM_002647.2       CCTGTAGGAGGAACAACGGTTTCGCTCTTTGGAAAATACGGCATGTTTCGCCAAGGGATG
                  ************************************************************

HsCD00022338      CATGACTTGAAAGTCTGGCCTAATGTAGAAGCAGATGGATCAGAACCCACAAAAACTCCT
NM_002647.2       CATGACTTGAAAGTCTGGCCTAATGTAGAAGCAGATGGATCAGAACCCACAAAAACTCCT
                  ************************************************************

HsCD00022338      GGCAGAACAAGTAGCACTCTCTCAGAAGATCAGATGAGCCGTCTTGCCAAGCTCACCAAA
NM_002647.2       GGCAGAACAAGTAGCACTCTCTCAGAAGATCAGATGAGCCGTCTTGCCAAGCTCACCAAA
                  ************************************************************

HsCD00022338      GCTCATCGACAAGGACACATGGTGAAAGTAGATTGGCTGGATAGATTGACATTTAGAGAA
NM_002647.2       GCTCATCGACAAGGACACATGGTGAAAGTAGATTGGCTGGATAGATTGACATTTAGAGAA
                  ************************************************************

HsCD00022338      ATAGAAATGATAAATGAGAGTGAAAAACGAAGTTCTAATTTCATGTACCTGATGGTTGAA
NM_002647.2       ATAGAAATGATAAATGAGAGTGAAAAACGAAGTTCTAATTTCATGTACCTGATGGTTGAA
                  ************************************************************

HsCD00022338      TTTCGATGTGTCAAGTGTGATGATAAGGAATATGGTATTGTTTATTATGAAAAGGACGGT
NM_002647.2       TTTCGATGTGTCAAGTGTGATGATAAGGAATATGGTATTGTTTATTATGAAAAGGACGGT
                  ************************************************************

HsCD00022338      GATGAATCATCTCCAATTTTAACAAGTTTTGAATTAGTGAAAGTTCCTGACCCCCAGATG
NM_002647.2       GATGAATCATCTCCAATTTTAACAAGTTTTGAATTAGTGAAAGTTCCTGACCCCCAGATG
                  ************************************************************

HsCD00022338      TCTATGGAGAATTTAGTTGAGAGCAAACACCACAAGCTTGCCCGGAGTTTAAGAAGTGGA
NM_002647.2       TCTATGGAGAATTTAGTTGAGAGCAAACACCACAAGCTTGCCCGGAGTTTAAGAAGTGGA
                  ************************************************************

HsCD00022338      CCTTCTGACCACGATCTGAAACCCAATGCTGCCACGAGAGATCAGTTAAATATTATTGTG
NM_002647.2       CCTTCTGACCACGATCTGAAACCCAATGCTGCCACGAGAGATCAGTTAAATATTATTGTG
                  ************************************************************

HsCD00022338      AGTTATCCACCAACCAAGCAACTTACATATGAAGAACAAGATCTTGTTTGGAAGTTTAGA
NM_002647.2       AGTTATCCACCAACCAAGCAACTTACATATGAAGAACAAGATCTTGTTTGGAAGTTTAGA
                  ************************************************************

HsCD00022338      TATTATCTTACGAATCAAGAAAAAGCCTTGACAAAATTCTTGAAATGTGTTAATTGGGAT
NM_002647.2       TATTATCTTACGAATCAAGAAAAAGCCTTGACAAAATTCTTGAAATGTGTTAATTGGGAT
                  ************************************************************

HsCD00022338      CTACCTCAAGAGGCCAAACAGGCCTTGGAACTTCTGGGAAAATGGAAGCCGATGGATGTA
NM_002647.2       CTACCTCAAGAGGCCAAACAGGCCTTGGAACTTCTGGGAAAATGGAAGCCGATGGATGTA
                  ************************************************************

HsCD00022338      GAGGACTCCTTGGAGCTGTTATCCTCTCATTACACCAACCCAACTGTGAGGCGTTATGCT
NM_002647.2       GAGGACTCCTTGGAGCTGTTATCCTCTCATTACACCAACCCAACTGTGAGGCGTTATGCT
                  ************************************************************

HsCD00022338      GTTGCCCGGTTGCGACAGGCCGATGATGAGGATTTGTTGATGTACCTATTACAATTGGTC
NM_002647.2       GTTGCCCGGTTGCGACAGGCCGATGATGAGGATTTGTTGATGTACCTATTACAATTGGTC
                  ************************************************************

HsCD00022338      CAGGCTCTCAAATATGAAAATTTTGATGATATAAAGAATGGATTGGAACCTACCAAGAAG
NM_002647.2       CAGGCTCTCAAATATGAAAATTTTGATGATATAAAGAATGGATTGGAACCTACCAAGAAG
                  ************************************************************

HsCD00022338      GATAGTCAGAGTTCAGTGTCAGAAAATGTGTCAAATTCTGGAATAAATTCTGCAGAAATA
NM_002647.2       GATAGTCAGAGTTCAGTGTCAGAAAATGTGTCAAATTCTGGAATAAATTCTGCAGAAATA
                  ************************************************************

HsCD00022338      GATAGCTCCCAAATTATAACCAGCCCCCTTCCTTCAGTCTCTTCACCTCCTCCTGCATCA
NM_002647.2       GATAGCTCCCAAATTATAACCAGCCCCCTTCCTTCAGTCTCTTCACCTCCTCCTGCATCA
                  ************************************************************

HsCD00022338      AAAACAAAAGAAGTTCCAGATGGCGAAAATCTGGAACAAGATCTCTGTACCTTCTTGATA
NM_002647.2       AAAACAAAAGAAGTTCCAGATGGCGAAAATCTGGAACAAGATCTCTGTACCTTCTTGATA
                  ************************************************************

HsCD00022338      TCGAGAGCCTGCAAAAACTCAACACTGGCTAATTATTTATACTGGTATGTGATAGTGGAA
NM_002647.2       TCGAGAGCCTGCAAAAACTCAACACTGGCTAATTATTTATACTGGTATGTGATAGTGGAA
                  ************************************************************

HsCD00022338      TGTGAAGATCAAGATACTCAGCAGAGAGATCCAAAGACCCATGAGATGTACTTGAACGTA
NM_002647.2       TGTGAAGATCAAGATACTCAGCAGAGAGATCCAAAGACCCATGAGATGTACTTGAACGTA
                  ************************************************************

HsCD00022338      ATGAGAAGATTCAGCCAAGCATTGTTGAAGGGTGATAAGTCTGTCAGAGTTATGCGTTCT
NM_002647.2       ATGAGAAGATTCAGCCAAGCATTGTTGAAGGGTGATAAGTCTGTCAGAGTTATGCGTTCT
                  ************************************************************

HsCD00022338      TTGCTGGCTGCACAACAGACATTTGTAGATCGGTTGGTGCATCTAATGAAGGCAGTACAA
NM_002647.2       TTGCTGGCTGCACAACAGACATTTGTAGATCGGTTGGTGCATCTAATGAAGGCAGTACAA
                  ************************************************************

HsCD00022338      CGCGAAAGTGGAAATCGTAAGAAAAAGAATGAGAGACTACAGGCATTGCTTGGAGATAAT
NM_002647.2       CGCGAAAGTGGAAATCGTAAGAAAAAGAATGAGAGACTACAGGCATTGCTTGGAGATAAT
                  ************************************************************

HsCD00022338      GAAAAGATGAATTTGTCAGATGTGGAACTTATCCCGTTGCCTTTAGAACCCCAAGTGAAA
NM_002647.2       GAAAAGATGAATTTGTCAGATGTGGAACTTATCCCGTTGCCTTTAGAACCCCAAGTGAAA
                  ************************************************************

HsCD00022338      ATTAGAGGAATAATTCCGGAAACAGCTACACTGTTTAAAAGTGCCCTTATGCCTGCACAG
NM_002647.2       ATTAGAGGAATAATTCCGGAAACAGCTACACTGTTTAAAAGTGCCCTTATGCCTGCACAG
                  ************************************************************

HsCD00022338      TTGTTTTTTAAGACGGAAGATGGAGGCAAATATCCAGTTATATTTAAGCATGGAGATGAT
NM_002647.2       TTGTTTTTTAAGACGGAAGATGGAGGCAAATATCCAGTTATATTTAAGCATGGAGATGAT
                  ************************************************************

HsCD00022338      TTACGTCAAGATCAACTTATTCTTCAAATCATTTCACTCATGGACAAGCTGTTACGGAAA
NM_002647.2       TTACGTCAAGATCAACTTATTCTTCAAATCATTTCACTCATGGACAAGCTGTTACGGAAA
                  ************************************************************

HsCD00022338      GAAAATCTGGACTTGAAATTGACACCTTATAAGGTGTTAGCCACCAGTACAAAACATGGC
NM_002647.2       GAAAATCTGGACTTGAAATTGACACCTTATAAGGTGTTAGCCACCAGTACAAAACATGGC
                  ************************************************************

HsCD00022338      TTCATGCAGTTTATCCAGTCAGTTCCTGTGGCTGAAGTTCTTGATACAGAGGGAAGCATT
NM_002647.2       TTCATGCAGTTTATCCAGTCAGTTCCTGTGGCTGAAGTTCTTGATACAGAGGGAAGCATT
                  ************************************************************

HsCD00022338      CAGAACTTTTTTAGAAAATATGCACCAAGTGAGAATGGGCCAAATGGGATTAGTGCTGAG
NM_002647.2       CAGAACTTTTTTAGAAAATATGCACCAAGTGAGAATGGGCCAAATGGGATTAGTGCTGAG
                  ************************************************************

HsCD00022338      GTCATGGACACTTACGTTAAAAGCTGTGCTGGATATTGCGTGATCACCTATATACTTGGA
NM_002647.2       GTCATGGACACTTACGTTAAAAGCTGTGCTGGATATTGCGTGATCACCTATATACTTGGA
                  ************************************************************

HsCD00022338      GTTGGAGACAGGCACCTGGATAACCTTTTGCTAACAAAAACAGGCAAACTCTTCCACATA
NM_002647.2       GTTGGAGACAGGCACCTGGATAACCTTTTGCTAACAAAAACAGGCAAACTCTTCCACATA
                  ************************************************************

HsCD00022338      GACTTTGGATATATTTTGGGTCGGGATCCAAAGCCTCTTCCTCCACCAATGAAGCTGAAT
NM_002647.2       GACTTTGGATATATTTTGGGTCGGGATCCAAAGCCTCTTCCTCCACCAATGAAGCTGAAT
                  ************************************************************

HsCD00022338      AAAGAAATGGTAGAAGGAATGGGGGGCACACAGAGTGAGCAGTACCAAGAGTTCCGTAAA
NM_002647.2       AAAGAAATGGTAGAAGGAATGGGGGGCACACAGAGTGAGCAGTACCAAGAGTTCCGTAAA
                  ************************************************************

HsCD00022338      CAGTGTTACACGGCTTTCCTCCACCTGCGAAGGTATTCTAATCTGATTTTGAACTTGTTT
NM_002647.2       CAGTGTTACACGGCTTTCCTCCACCTGCGAAGGTATTCTAATCTGATTTTGAACTTGTTT
                  ************************************************************

HsCD00022338      TCCTTGATGGTTGATGCAAACATTCCAGATATTGCACTTGAACCAGATAAAACTGTGAAA
NM_002647.2       TCCTTGATGGTTGATGCAAACATTCCAGATATTGCACTTGAACCAGATAAAACTGTGAAA
                  ************************************************************

HsCD00022338      AAGGTTCAGGATAAATTCCGCTTAGACCTGTCGGATGAAGAGGCTGTGCATTACATGCAG
NM_002647.2       AAGGTTCAGGATAAATTCCGCTTAGACCTGTCGGATGAAGAGGCTGTGCATTACATGCAG
                  ************************************************************

HsCD00022338      AGTCTGATTGATGAGAGTGTCCATGCTCTTTTTGCTGCAGTGGTGGAACAGATTCACAAG
NM_002647.2       AGTCTGATTGATGAGAGTGTCCATGCTCTTTTTGCTGCAGTGGTGGAACAGATTCACAAG
                  ************************************************************

HsCD00022338      TTTGCCCAGTACTGGAGAAAATTG
NM_002647.2       TTTGCCCAGTACTGGAGAAAATGA
                  ********************** .

Pathways

Panther : Angiogenesis
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : PI Metabolism
Reactome : PI3K Cascade
Reactome : Phospholipid metabolism
Reactome : Signal Transduction
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Synthesis of PIPs at the Golgi membrane
Reactome : Synthesis of PIPs at the early endosome membrane
Reactome : Synthesis of PIPs at the late endosome membrane
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : AMPK signaling
WikiPathway : Insulin Signaling
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Senescence and Autophagy

Clone

Cloning Information : 147911
HIP Master Clone ID : 124230
Original Clone ID : FLH147911.01L

Organism


TAX_ID : 9606
Species Specific ID: 5289

Genome

Chromosome : 18
Map Location : 18q12.3

Reagents

Labome : PIK3C3-antibody