DNASU Plasmid Repository • 480.965.5697 | Email

RRAS (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RRAS
Gene Name:  related RAS viral (r-ras) oncogene homolog
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH015469.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00002310

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 657nts         Open reading frame : 1 to 657
Reference Sequence Alignment

ATGAGCAGCGGGGCGGCGTCCGGGACAGGGCGGGGGCGGCCCCGGGGCGGGGGACCTGGG
CCCGGGGACCCCCCGCCCAGCGAGACACACAAGCTGGTGGTCGTGGGCGGCGGCGGCGTG
GGCAAGAGCGCGCTGACCATCCAGTTCATCCAGTCCTACTTCGTGTCTGACTACGACCCC
ACTATTGAGGACTCCTACACGAAGATCTGCAGTGTGGATGGCATCCCAGCCCGGCTGGAC
ATCCTGGACACCGCGGGCCAGGAAGAGTTCGGGGCCATGAGAGAGCAGTACATGCGTGCT
GGCCACGGCTTCCTGCTGGTGTTCGCCATTAACGACCGGCAGAGTTTCAACGAGGTGGGC
AAGCTCTTCACGCAGATTCTGCGGGTCAAGGACCGCGACGACTTCCCCGTTGTGTTGGTC
GGGAACAAGGCAGATCTGGAGTCACAGCGCCAGGTCCCCCGATCAGAAGCCTCTGCCTTC
GGCGCCTCCCACCACGTGGCCTACTTTGAGGCCTCGGCCAAACTGCGTCTCAACGTGGAC
GAGGCTTTTGAGCAGCTGGTGCGGGCTGTCCGGAAATACCAGGAACAAGAGCTCCCACCG
AGCCCTCCCAGTGCCCCCAGGAAGAAGGGCGGGGGCTGCCCCTGCGTCCTCCTGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 681
Start on reference sequence 25
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RRAS
Symbol Nomenclature : RRAS
Designation : Oncogene RRAS|p23|ras-related protein R-Ras
Full Nomenclature : related RAS viral (r-ras) oncogene homolog
GENEID : 6237
GI : 61360967
GenBank Accession : AY889021
HGNC : 10447
MIM : 165090
Vega : OTTHUMG00000183247
Target GenBank: BC016286

 

Reference Sequence Alignment

  

HsCD00002310      ATGAGCAGCGGGGCGGCGTCCGGGACAGGGCGGGGGCGGCCCCGGGGCGGGGGACCTGGG
NM_006270.3       ATGAGCAGCGGGGCGGCGTCCGGGACAGGGCGGGGGCGGCCCCGGGGCGGGGGACCTGGG
                  ************************************************************

HsCD00002310      CCCGGGGACCCCCCGCCCAGCGAGACACACAAGCTGGTGGTCGTGGGCGGCGGCGGCGTG
NM_006270.3       CCCGGGGACCCCCCGCCCAGCGAGACACACAAGCTGGTGGTCGTGGGCGGCGGCGGCGTG
                  ************************************************************

HsCD00002310      GGCAAGAGCGCGCTGACCATCCAGTTCATCCAGTCCTACTTCGTGTCTGACTACGACCCC
NM_006270.3       GGCAAGAGCGCGCTGACCATCCAGTTCATCCAGTCCTACTTCGTGTCTGACTACGACCCC
                  ************************************************************

HsCD00002310      ACTATTGAGGACTCCTACACGAAGATCTGCAGTGTGGATGGCATCCCAGCCCGGCTGGAC
NM_006270.3       ACTATTGAGGACTCCTACACGAAGATCTGCAGTGTGGATGGCATCCCAGCCCGGCTGGAC
                  ************************************************************

HsCD00002310      ATCCTGGACACCGCGGGCCAGGAAGAGTTCGGGGCCATGAGAGAGCAGTACATGCGTGCT
NM_006270.3       ATCCTGGACACCGCGGGCCAGGAAGAGTTCGGGGCCATGAGAGAGCAGTACATGCGTGCT
                  ************************************************************

HsCD00002310      GGCCACGGCTTCCTGCTGGTGTTCGCCATTAACGACCGGCAGAGTTTCAACGAGGTGGGC
NM_006270.3       GGCCACGGCTTCCTGCTGGTGTTCGCCATTAACGACCGGCAGAGTTTCAACGAGGTGGGC
                  ************************************************************

HsCD00002310      AAGCTCTTCACGCAGATTCTGCGGGTCAAGGACCGCGACGACTTCCCCGTTGTGTTGGTC
NM_006270.3       AAGCTCTTCACGCAGATTCTGCGGGTCAAGGACCGCGACGACTTCCCCGTTGTGTTGGTC
                  ************************************************************

HsCD00002310      GGGAACAAGGCAGATCTGGAGTCACAGCGCCAGGTCCCCCGATCAGAAGCCTCTGCCTTC
NM_006270.3       GGGAACAAGGCAGATCTGGAGTCACAGCGCCAGGTCCCCCGATCAGAAGCCTCTGCCTTC
                  ************************************************************

HsCD00002310      GGCGCCTCCCACCACGTGGCCTACTTTGAGGCCTCGGCCAAACTGCGTCTCAACGTGGAC
NM_006270.3       GGCGCCTCCCACCACGTGGCCTACTTTGAGGCCTCGGCCAAACTGCGTCTCAACGTGGAC
                  ************************************************************

HsCD00002310      GAGGCTTTTGAGCAGCTGGTGCGGGCTGTCCGGAAATACCAGGAACAAGAGCTCCCACCG
NM_006270.3       GAGGCTTTTGAGCAGCTGGTGCGGGCTGTCCGGAAATACCAGGAACAAGAGCTCCCACCG
                  ************************************************************

HsCD00002310      AGCCCTCCCAGTGCCCCCAGGAAGAAGGGCGGGGGCTGCCCCTGCGTCCTCCTGTAG
NM_006270.3       AGCCCTCCCAGTGCCCCCAGGAAGAAGGGCGGGGGCTGCCCCTGCGTCCTCCTGTAG
                  *********************************************************

Pathways

NCI : EPHB forward signaling
NCI : Plexin-D1 Signaling
NCI : Regulation of Ras family activation
NCI : Signaling events mediated by focal adhesion kinase
Panther : EGF receptor signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Integrin signalling pathway
Panther : TGF-beta signaling pathway
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Axon guidance
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Developmental Biology
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Post NMDA receptor activation events
Reactome : SEMA3A-Plexin repulsion signaling by inhibiting Integrin adhesion
Reactome : Sema4D in semaphorin signaling
Reactome : Sema4D mediated inhibition of cell attachment and migration
Reactome : Semaphorin interactions
Reactome : Transmission across Chemical Synapses
WikiPathway : G Protein Signaling Pathways
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : MAPK Cascade
WikiPathway : Regulation of Actin Cytoskeleton

Clone

Cloning Information : 15469
HIP Master Clone ID : 29668
Original Clone ID : FLH015469.01X

Organism


TAX_ID : 9606
Species Specific ID: 6237

Genome

Chromosome : 19
Map Location : 19q13.33
Ensembl : ENSG00000126458

Reagents

Labome : RRAS-antibody