DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pANT7_cGST

TOP

Explanation of Terms


Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: pANT7_cGST
Type: No insert
Vector Name: pANT7_cGST              
Source: HIP
Description: in vitro expression vector, makes C-term GST fusion; amp resistance; recombinational cloning.
Comments: Constructed at HIP for expression via T7 coupled Rabbit retic lysate for NAPPA protein arrays; note difference growth, host for empty vector versus with insert forms
Publications: PMID: 15232106
Title: Self-assembling protein microarrays
Authors: Al Lau
Niroshan Ramachandran
Joshua LaBaer
EvNO00023103

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

 

 Recommended Growth Condition:

Distributed in bacterial strain : DB3.1
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: in vitro expression vector, makes C-term GST fusion; amp resistance; recombinational cloning.
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3249 3931
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2384 2405
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4029 4688
tag GST Glutathione transferase (GST) tag 2282 2950

 

Original Clone ID: pANT7_cGST
Species Specific ID: None
Target GenBank: None