DNASU Plasmid Repository • 480.965.5697 | Email

PRKR (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  EIF2AK2
Gene Name:  eukaryotic translation initiation factor 2-alpha kinase 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH117994.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000024

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1656nts         Open reading frame : 1 to 1656
Reference Sequence Alignment

ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTCAGAAG
CAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTCAGGACCTCCACATGATAGGAGG
TTTACATTTCAAGTTATAATAGATGGAAGAGAATTTCCAGAAGGTGAAGGTAGATCAAAG
AAGGAAGCAAAAAATGCCGCAGCCAAATTAGCTGTTGAGATACTTAATAAGGAAAAGAAG
GCAGTTAGTCCTTTATTATTGACAACAACGAATTCTTCAGAAGGATTATCCATGGGGAAT
TACATAGGCCTTATCAATAGAATTGCCCAGAAGAAAAGACTAACTGTAAATTATGAACAG
TGTGCATCGGGGGTGCATGGGCCAGAAGGATTTCATTATAAATGCAAAATGGGACAGAAA
GAATATAGTATTGGTACAGGTTCTACTAAACAGGAAGCAAAACAATTGGCCGCTAAACTT
GCATATCTTCAGATATTATCAGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGT
TCTTTTGCTACTACGTGTGAGTCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTCT
GAATCATCATCTGAAGGTGACTTCTCAGCAGATACATCAGAGATAAATTCTAACAGTGAC
AGTTTAAACAGTTCTTCGTTGCTTATGAATGGTCTCAGAAATAATCAAAGGAAGGCAAAA
AGATCTTTGGCACCCAGATTTGACCTTCCTGACATGAAAGAAACAAAGTATACTGTGGAC
AAGAGGTTTGGCATGGATTTTAAAGAAATAGAATTAATTGGCTCAGGTGGATTTGGCCAA
GTTTTCAAAGCAAAACACAGAATTGACGGAAAGACTTACGTTATTAAACGTGTTAAATAT
AATAACGAGAAGGCGGAGCGTGAAGTAAAAGCATTGGCAAAACTTGATCATGTAAATATT
GTTCACTACAATGGCTGTTGGGATGGATTTGATTATGATCCTGAGACCAGTGATGATTCT
CTTGAGAGCAGTGATTATGATCCTGAGAACAGCAAAAATAGTTCAAGGTCAAAGACTAAG
TGCCTTTTCATCCAAATGGAATTCTGTGATAAAGGGACCTTGGAACAATGGATTGAAAAA
AGAAGAGGCGAGAAACTAGACAAAGTTTTGGCTTTGGAACTCTTTGAACAAATAACAAAA
GGGGTGGATTATATACATTCAAAAAAATTAATTCATAGAGATCTTAAGCCAAGTAATATA
TTCTTAGTAGATACAAAACAAGTAAAGATTGGAGACTTTGGACTTGTAACATCTCTGAAA
AATGATGGAAAGCGAACAAGGAGTAAGGGAACTTTGCGATACATGAGCCCAGAACAGATT
TCTTCGCAAGACTATGGAAAGGAAGTGGACCTCTACGCTTTGGGGCTAATTCTTGCTGAA
CTTCTTCATGTATGTGACACTGCTTTTGAAACATCAAAGTTTTTCACAGACCTACGGGAT
GGCATCATCTCAGATATATTTGATAAAAAAGAAAAAACTCTTCTACAGAAATTACTCTCA
AAGAAACCTGAGGATCGACCTAACACATCTGAAATACTAAGGACCTTGACTGTGTGGAAG
AAAAGCCCAGAGAAAAATGAACGACACACATGTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2091
Start on reference sequence 436
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : EIF2AK2
Symbol Nomenclature : EIF2AK2
SYNONYM : EIF2AK1; PKR; PRKR
Designation : P1/eIF-2A protein kinase|double stranded RNA activated protein kinase|eIF-2A protein kinase 2|interferon-induced, double-stranded RNA-activated protein kinase|interferon-inducible elF2alpha kinase|p68 kinase|protein kinase, interferon-inducible double stranded RNA dependent|tyrosine-protein kinase EIF2AK2
Full Nomenclature : eukaryotic translation initiation factor 2-alpha kinase 2
GENEID : 5610
GI : 61354794
GenBank Accession : AY888113
HGNC : 9437
MIM : 176871
Target GenBank: NM_002759

 

Reference Sequence Alignment

  

HsCD00000024        ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTCAGAAG
NM_001135651.2      ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTCAGAAG
NM_002759.3         ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTCAGAAG
NM_001135652.2      ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTCAGAAG
                    ************************************************************

HsCD00000024        CAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTCAGGACCTCCACATGATAGGAGG
NM_001135651.2      CAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTCAGGACCTCCACATGATAGGAGG
NM_002759.3         CAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTCAGGACCTCCACATGATAGGAGG
NM_001135652.2      CAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTCAGGACCTCCACATGATAGGAGG
                    ************************************************************

HsCD00000024        TTTACATTTCAAGTTATAATAGATGGAAGAGAATTTCCAGAAGGTGAAGGTAGATCAAAG
NM_001135651.2      TTTACATTTCAAGTTATAATAGATGGAAGAGAATTTCCAGAAGGTGAAGGTAGATCAAAG
NM_002759.3         TTTACATTTCAAGTTATAATAGATGGAAGAGAATTTCCAGAAGGTGAAGGTAGATCAAAG
NM_001135652.2      TTTACATTTCAAGTTATAATAGATGGAAGAGAATTTCCAGAAGGTGAAGGTAGATCAAAG
                    ************************************************************

HsCD00000024        AAGGAAGCAAAAAATGCCGCAGCCAAATTAGCTGTTGAGATACTTAATAAGGAAAAGAAG
NM_001135651.2      AAGGAAGCAAAAAATGCCGCAGCCAAATTAGCTGTTGAGATACTTAATAAGGAAAAGAAG
NM_002759.3         AAGGAAGCAAAAAATGCCGCAGCCAAATTAGCTGTTGAGATACTTAATAAGGAAAAGAAG
NM_001135652.2      AAGGAAGCAAAAAATGCCGCAGCCAAATTAGCTGTTGAGATACTTAATAAGGAAAAGAAG
                    ************************************************************

HsCD00000024        GCAGTTAGTCCTTTATTATTGACAACAACGAATTCTTCAGAAGGATTATCCATGGGGAAT
NM_001135651.2      GCAGTTAGTCCTTTATTATTGACAACAACGAATTCTTCAGAAGGATTATCCATGGGGAAT
NM_002759.3         GCAGTTAGTCCTTTATTATTGACAACAACGAATTCTTCAGAAGGATTATCCATGGGGAAT
NM_001135652.2      GCAGTTAGTCCTTTATTATTGACAACAACGAATTCTTCAGAAGGATTATCCATGGGGAAT
                    ************************************************************

HsCD00000024        TACATAGGCCTTATCAATAGAATTGCCCAGAAGAAAAGACTAACTGTAAATTATGAACAG
NM_001135651.2      TACATAGGCCTTATCAATAGAATTGCCCAGAAGAAAAGACTAACTGTAAATTATGAACAG
NM_002759.3         TACATAGGCCTTATCAATAGAATTGCCCAGAAGAAAAGACTAACTGTAAATTATGAACAG
NM_001135652.2      TACATAGGCCTTATCAATAGAATTGCCCAGAAGAAAAGACTAACTGTAAATTATGAACAG
                    ************************************************************

HsCD00000024        TGTGCATCGGGGGTGCATGGGCCAGAAGGATTTCATTATAAATGCAAAATGGGACAGAAA
NM_001135651.2      TGTGCATCGGGGGTGCATGGGCCAGAAGGATTTCATTATAAATGCAAAATGGGACAGAAA
NM_002759.3         TGTGCATCGGGGGTGCATGGGCCAGAAGGATTTCATTATAAATGCAAAATGGGACAGAAA
NM_001135652.2      TGTGCATCGGGGGTGCATGGGCCAGAAGGATTTCATTATAAATGCAAAATGGGACAGAAA
                    ************************************************************

HsCD00000024        GAATATAGTATTGGTACAGGTTCTACTAAACAGGAAGCAAAACAATTGGCCGCTAAACTT
NM_001135651.2      GAATATAGTATTGGTACAGGTTCTACTAAACAGGAAGCAAAACAATTGGCCGCTAAACTT
NM_002759.3         GAATATAGTATTGGTACAGGTTCTACTAAACAGGAAGCAAAACAATTGGCCGCTAAACTT
NM_001135652.2      GAATATAGTATTGGTACAGGTTCTACTAAACAGGAAGCAAAACAATTGGCCGCTAAACTT
                    ************************************************************

HsCD00000024        GCATATCTTCAGATATTATCAGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGT
NM_001135651.2      GCATATCTTCAGATATTATCAGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGT
NM_002759.3         GCATATCTTCAGATATTATCAGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGT
NM_001135652.2      GCATATCTTCAGATATTATCAGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGT
                    ************************************************************

HsCD00000024        TCTTTTGCTACTACGTGTGAGTCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTCT
NM_001135651.2      TCTTTTGCTACTACGTGTGAGTCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTCT
NM_002759.3         TCTTTTGCTACTACGTGTGAGTCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTCT
NM_001135652.2      TCTTTTGCTACTACGTGTGAGTCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTCT
                    ************************************************************

HsCD00000024        GAATCATCATCTGAAGGTGACTTCTCAGCAGATACATCAGAGATAAATTCTAACAGTGAC
NM_001135651.2      GAATCATCATCTGAAGGTGACTTCTCAGCAGATACATCAGAGATAAATTCTAACAGTGAC
NM_002759.3         GAATCATCATCTGAAGGTGACTTCTCAGCAGATACATCAGAGATAAATTCTAACAGTGAC
NM_001135652.2      GAATCATCATCTGAAGGTGACTTCTCAGCAGATACATCAGAGATAAATTCTAACAGTGAC
                    ************************************************************

HsCD00000024        AGTTTAAACAGTTCTTCGTTGCTTATGAATGGTCTCAGAAATAATCAAAGGAAGGCAAAA
NM_001135651.2      AGTTTAAACAGTTCTTCGTTGCTTATGAATGGTCTCAGAAATAATCAAAGGAAGGCAAAA
NM_002759.3         AGTTTAAACAGTTCTTCGTTGCTTATGAATGGTCTCAGAAATAATCAAAGGAAGGCAAAA
NM_001135652.2      AGTTTAAACAGTTCTTCGTTGCTTATGAATGGTCTCAGAAATAATCAAAGGAAGGCAAAA
                    ************************************************************

HsCD00000024        AGATCTTTGGCACCCAGATTTGACCTTCCTGACATGAAAGAAACAAAGTATACTGTGGAC
NM_001135651.2      AGATCTTTGGCACCCAGATTTGACCTTCCTGACATGAAAGAAACAAAGTATACTGTGGAC
NM_002759.3         AGATCTTTGGCACCCAGATTTGACCTTCCTGACATGAAAGAAACAAAGTATACTGTGGAC
NM_001135652.2      AGATCTTTGGCACCCAGATTTGACCTTCCTGACATGAAAGAAACAAAGTATACTGTGGAC
                    ************************************************************

HsCD00000024        AAGAGGTTTGGCATGGATTTTAAAGAAATAGAATTAATTGGCTCAGGTGGATTTGGCCAA
NM_001135651.2      AAGAGGTTTGGCATGGATTTTAAAGAAATAGAATTAATTGGCTCAGGTGGATTTGGCCAA
NM_002759.3         AAGAGGTTTGGCATGGATTTTAAAGAAATAGAATTAATTGGCTCAGGTGGATTTGGCCAA
NM_001135652.2      AAGAG-------------------------------------------------------
                    *****                                                       

HsCD00000024        GTTTTCAAAGCAAAACACAGAATTGACGGAAAGACTTACGTTATTAAACGTGTTAAATAT
NM_001135651.2      GTTTTCAAAGCAAAACACAGAATTGACGGAAAGACTTACGTTATTAAACGTGTTAAATAT
NM_002759.3         GTTTTCAAAGCAAAACACAGAATTGACGGAAAGACTTACGTTATTAAACGTGTTAAATAT
NM_001135652.2      ------------------------------------------------------------
                                                                                

HsCD00000024        AATAACGAGAAGGCGGAGCGTGAAGTAAAAGCATTGGCAAAACTTGATCATGTAAATATT
NM_001135651.2      AATAACGAGAAGGCGGAGCGTGAAGTAAAAGCATTGGCAAAACTTGATCATGTAAATATT
NM_002759.3         AATAACGAGAAGGCGGAGCGTGAAGTAAAAGCATTGGCAAAACTTGATCATGTAAATATT
NM_001135652.2      --------GAAGGCGGAGCGTGAAGTAAAAGCATTGGCAAAACTTGATCATGTAAATATT
                            ****************************************************

HsCD00000024        GTTCACTACAATGGCTGTTGGGATGGATTTGATTATGATCCTGAGACCAGTGATGATTCT
NM_001135651.2      GTTCACTACAATGGCTGTTGGGATGGATTTGATTATGATCCTGAGACCAGTGATGATTCT
NM_002759.3         GTTCACTACAATGGCTGTTGGGATGGATTTGATTATGATCCTGAGACCAGTGATGATTCT
NM_001135652.2      GTTCACTACAATGGCTGTTGGGATGGATTTGATTATGATCCTGAGACCAGTGATGATTCT
                    ************************************************************

HsCD00000024        CTTGAGAGCAGTGATTATGATCCTGAGAACAGCAAAAATAGTTCAAGGTCAAAGACTAAG
NM_001135651.2      CTTGAGAGCAGTGATTATGATCCTGAGAACAGCAAAAATAGTTCAAGGTCAAAGACTAAG
NM_002759.3         CTTGAGAGCAGTGATTATGATCCTGAGAACAGCAAAAATAGTTCAAGGTCAAAGACTAAG
NM_001135652.2      CTTGAGAGCAGTGATTATGATCCTGAGAACAGCAAAAATAGTTCAAGGTCAAAGACTAAG
                    ************************************************************

HsCD00000024        TGCCTTTTCATCCAAATGGAATTCTGTGATAAAGGGACCTTGGAACAATGGATTGAAAAA
NM_001135651.2      TGCCTTTTCATCCAAATGGAATTCTGTGATAAAGGGACCTTGGAACAATGGATTGAAAAA
NM_002759.3         TGCCTTTTCATCCAAATGGAATTCTGTGATAAAGGGACCTTGGAACAATGGATTGAAAAA
NM_001135652.2      TGCCTTTTCATCCAAATGGAATTCTGTGATAAAGGGACCTTGGAACAATGGATTGAAAAA
                    ************************************************************

HsCD00000024        AGAAGAGGCGAGAAACTAGACAAAGTTTTGGCTTTGGAACTCTTTGAACAAATAACAAAA
NM_001135651.2      AGAAGAGGCGAGAAACTAGACAAAGTTTTGGCTTTGGAACTCTTTGAACAAATAACAAAA
NM_002759.3         AGAAGAGGCGAGAAACTAGACAAAGTTTTGGCTTTGGAACTCTTTGAACAAATAACAAAA
NM_001135652.2      AGAAGAGGCGAGAAACTAGACAAAGTTTTGGCTTTGGAACTCTTTGAACAAATAACAAAA
                    ************************************************************

HsCD00000024        GGGGTGGATTATATACATTCAAAAAAATTAATTCATAGAGATCTTAAGCCAAGTAATATA
NM_001135651.2      GGGGTGGATTATATACATTCAAAAAAATTAATTCATAGAGATCTTAAGCCAAGTAATATA
NM_002759.3         GGGGTGGATTATATACATTCAAAAAAATTAATTCATAGAGATCTTAAGCCAAGTAATATA
NM_001135652.2      GGGGTGGATTATATACATTCAAAAAAATTAATTCATAGAGATCTTAAGCCAAGTAATATA
                    ************************************************************

HsCD00000024        TTCTTAGTAGATACAAAACAAGTAAAGATTGGAGACTTTGGACTTGTAACATCTCTGAAA
NM_001135651.2      TTCTTAGTAGATACAAAACAAGTAAAGATTGGAGACTTTGGACTTGTAACATCTCTGAAA
NM_002759.3         TTCTTAGTAGATACAAAACAAGTAAAGATTGGAGACTTTGGACTTGTAACATCTCTGAAA
NM_001135652.2      TTCTTAGTAGATACAAAACAAGTAAAGATTGGAGACTTTGGACTTGTAACATCTCTGAAA
                    ************************************************************

HsCD00000024        AATGATGGAAAGCGAACAAGGAGTAAGGGAACTTTGCGATACATGAGCCCAGAACAGATT
NM_001135651.2      AATGATGGAAAGCGAACAAGGAGTAAGGGAACTTTGCGATACATGAGCCCAGAACAGATT
NM_002759.3         AATGATGGAAAGCGAACAAGGAGTAAGGGAACTTTGCGATACATGAGCCCAGAACAGATT
NM_001135652.2      AATGATGGAAAGCGAACAAGGAGTAAGGGAACTTTGCGATACATGAGCCCAGAACAGATT
                    ************************************************************

HsCD00000024        TCTTCGCAAGACTATGGAAAGGAAGTGGACCTCTACGCTTTGGGGCTAATTCTTGCTGAA
NM_001135651.2      TCTTCGCAAGACTATGGAAAGGAAGTGGACCTCTACGCTTTGGGGCTAATTCTTGCTGAA
NM_002759.3         TCTTCGCAAGACTATGGAAAGGAAGTGGACCTCTACGCTTTGGGGCTAATTCTTGCTGAA
NM_001135652.2      TCTTCGCAAGACTATGGAAAGGAAGTGGACCTCTACGCTTTGGGGCTAATTCTTGCTGAA
                    ************************************************************

HsCD00000024        CTTCTTCATGTATGTGACACTGCTTTTGAAACATCAAAGTTTTTCACAGACCTACGGGAT
NM_001135651.2      CTTCTTCATGTATGTGACACTGCTTTTGAAACATCAAAGTTTTTCACAGACCTACGGGAT
NM_002759.3         CTTCTTCATGTATGTGACACTGCTTTTGAAACATCAAAGTTTTTCACAGACCTACGGGAT
NM_001135652.2      CTTCTTCATGTATGTGACACTGCTTTTGAAACATCAAAGTTTTTCACAGACCTACGGGAT
                    ************************************************************

HsCD00000024        GGCATCATCTCAGATATATTTGATAAAAAAGAAAAAACTCTTCTACAGAAATTACTCTCA
NM_001135651.2      GGCATCATCTCAGATATATTTGATAAAAAAGAAAAAACTCTTCTACAGAAATTACTCTCA
NM_002759.3         GGCATCATCTCAGATATATTTGATAAAAAAGAAAAAACTCTTCTACAGAAATTACTCTCA
NM_001135652.2      GGCATCATCTCAGATATATTTGATAAAAAAGAAAAAACTCTTCTACAGAAATTACTCTCA
                    ************************************************************

HsCD00000024        AAGAAACCTGAGGATCGACCTAACACATCTGAAATACTAAGGACCTTGACTGTGTGGAAG
NM_001135651.2      AAGAAACCTGAGGATCGACCTAACACATCTGAAATACTAAGGACCTTGACTGTGTGGAAG
NM_002759.3         AAGAAACCTGAGGATCGACCTAACACATCTGAAATACTAAGGACCTTGACTGTGTGGAAG
NM_001135652.2      AAGAAACCTGAGGATCGACCTAACACATCTGAAATACTAAGGACCTTGACTGTGTGGAAG
                    ************************************************************

HsCD00000024        AAAAGCCCAGAGAAAAATGAACGACACACATGTTAG
NM_001135651.2      AAAAGCCCAGAGAAAAATGAACGACACACATGTTAG
NM_002759.3         AAAAGCCCAGAGAAAAATGAACGACACACATGTTAG
NM_001135652.2      AAAAGCCCAGAGAAAAATGAACGACACACATGTTAG
                    ************************************

Pathways

NCI : Ceramide signaling pathway
NCI : PDGFR-beta signaling pathway
NCI : Signaling events mediated by TCPTP
Panther : Apoptosis signaling pathway
Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Cytokine Signaling in Immune system
Reactome : Disease
Reactome : Host Interactions with Influenza Factors
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Influenza Infection
Reactome : Inhibition of PKR
Reactome : Interferon Signaling
Reactome : NS1 Mediated Effects on Host Pathways
WikiPathway : Translation Factors
WikiPathway : Type II interferon signaling (IFNG)

Clone

Cloning Information : 117994
HIP Master Clone ID : 93840
Original Clone ID : FLH117994.01X

Organism


TAX_ID : 9606
Species Specific ID: 5610

Genome

Chromosome : 2
Map Location : 2p22-p21
Ensembl : ENSG00000055332

Reagents

Labome : PKR-antibody