DNASU Plasmid Repository • 480.965.5697 | Email

DVL2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  DVL2
Gene Name:  dishevelled segment polarity protein 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH109599.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00002486

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2211nts         Open reading frame : 1 to 2211
Reference Sequence Alignment

ATGGCGGGTAGCAGCACTGGGGGCGGTGGGGTTGGGGAGACGAAGGTGATTTACCACCTG
GATGAGGAAGAGACTCCCTACCTGGTGAAGATCCCTGTCCCCGCCGAGCGCATCACCCTC
GGCGATTTCAAGAGCGTCCTGCAGCGGCCCGCGGGCGCCAAGTACTTTTTCAAGTCTATG
GATCAGGATTTCGGGGTGGTGAAGGAAGAAATTTCAGATGACAACGCCCGCCTCCCCTGC
TTCAACGGAAGGGTGGTATCCTGGCTGGTGTCCTCAGATAATCCCCAACCCGAGATGGCC
CCTCCAGTCCATGAGCCTCGGGCAGAACTGGCGCCTCCAGCCCCACCTTTACCTCCTTTG
CCACCCGAGAGGACCAGCGGCATTGGGGACTCAAGGCCTCCATCCTTCCACCCTAATGTG
TCCAGCAGCCATGAGAATCTGGAGCCTGAGACAGAAACCGAGTCAGTAGTGTCACTGAGG
CGGGAGCGGCCTCGCAGGAGAGACAGCAGTGAGCATGGCGCTGGGGGCCACAGGACTGGT
GGCCCCTCAAGGCTGGAGCGCCACCTGGCCGGATACGAGAGCTCCTCTACCCTCATGACC
AGCGAGCTGGAGAGTACCAGCCTGGGGGACTCGGACGAGGAGGACACCATGAGCAGGTTC
AGCAGCTCCACGGAGCAGAGCAGTGCCTCCCGCCTCCTTAAGCGCCACCGGCGGCGAAGG
AAGCAGAGGCCACCCCGCCTGGAGAGGACGTCATCCTTCAGCAGCGTCACAGATTCCACA
ATGTCTCTCAATATCATCACAGTCACGCTAAACATGGAGAAGTACAACTTCCTGGGTATC
TCCATTGTTGGCCAGAGCAATGAGCGGGGAGACGGAGGCATCTACATTGGCTCCATCATG
AAGGGTGGGGCTGTGGCGGCCGACGGGCGCATTGAGCCAGGGGACATGCTTTTGCAGGTG
AATGACATGAACTTTGAGAACATGAGCAACGATGACGCTGTGCGGGTGCTGAGGGACATT
GTGCACAAGCCTGGCCCCATTGTGCTGACTGTGGCCAAGTGCTGGGATCCCTCTCCTCAG
GCCTATTTCACTCTCCCCCGAAATGAGCCCATCCAGCCAATTGACCCTGCTGCCTGGGTG
TCCCATTCCGCGGCTCTGACTGGCACCTTCCCAGCCTATCCAGGTTCCTCCTCCATGAGC
ACCATTACATCTGGATCGTCTTTGCCTGATGGCTGTGAAGGCCGGGGTCTCTCCGTCCAT
ACGGACATGGCATCGGTGACCAAGGCCATGGCAGCTCCAGAGTCTGGACTGGAAGTCCGG
GACCGCATGTGGCTCAAGATCACCATCCCTAATGCCTTTCTGGGCTCGGATGTGGTTGAC
TGGCTCTACCATCACGTGGAGGGCTTTCCTGAGCGGCGGGAGGCCCGCAAGTATGCCAGC
GGGCTGCTCAAAGCAGGCCTGATCCGACACACCGTCAACAAGATCACCTTCTCTGAGCAG
TGCTATTACGTCTTCGGAGACCTCAGTGGTGGCTGTGAGAGCTACCTAGTCAACCTGTCT
CTCAATGACAACGATGGCTCCAGTGGGGCTTCAGACCAGGATACCCTGGCTCCTCTGCCT
GGGGCCACCCCCTGGCCCCTGCTGCCCACTTTCTCCTACCAATACCCTGCCCCACACCCC
TACAGCCCGCAGCCTCCACCCTACCATGAGCTTTCATCTTACACCTATGGTGGGGGCAGT
GCCAGCAGCCAGCATAGTGAGGGCAGCCGGAGCAGTGGGTCGACACGGAGTGATGGGGGG
GCAGGGCGCACGGGGAGGCCCGAGGAGCGGGCCCCCGAGTCCAAGTCCGGCAGTGGCAGT
GAGTCTGAGCCCTCCAGCCGAGGGGGCAGCCTTCGGCGGGGTGGGGAAGCAAGTGGGACT
AGCGATGGGGGCCCTCCTCCATCCAGAGGCTCAACTGGGGGTGCCCCTAATCTCCGAGCC
CACCCAGGGCTCCATCCCTATGGACCGCCCCCTGGCATGGCCCTCCCCTACAACCCCATG
ATGGTGGTCATGATGCCCCCACCTCCACCTCCAGTCCCTCCAGCAGTGCAGCCTCCGGGG
GCCCCTCCAGTCAGAGACCTGGGCTCTGTGCCCCCAGAACTGACAGCCAGCCGCCAAAGC
TTCCACATGGCCATGGGCAATCCCAGCGAGTTCTTTGTGGATGTTATGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2306
Start on reference sequence 96
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : DVL2
Symbol Nomenclature : DVL2
Designation : dishevelled 2 (homologous to Drosophila dsh)|dishevelled, dsh homolog 2|segment polarity protein dishevelled homolog DVL-2
Full Nomenclature : dishevelled segment polarity protein 2
GENEID : 1856
GI : 60654716
GenBank Accession : AY889132
HGNC : 3086
MIM : 602151
Vega : OTTHUMG00000102155
Target GenBank: BC014844

 

Reference Sequence Alignment

  

HsCD00002486        ATGGCGGGTAGCAGCACTGGGGGCGGTGGGGTTGGGGAGACGAAGGTGATTTACCACCTG
XM_005256502.1      ATGGCGGGTAGCAGCACTGGGGGCGGTGGGGTTGGGGAGACGAAGGTGATTTACCACCTG
NM_004422.2         ATGGCGGGTAGCAGCACTGGGGGCGGTGGGGTTGGGGAGACGAAGGTGATTTACCACCTG
NM_004423.3         ------------------------------ATGGGCGAGACCAAGATCATCTACCACTTG
                                                  .* ** ***** ***.* ** ****** **

HsCD00002486        GATGAGGAAGAGACTCCCTACCTGGTGAAGATCCCTGTCCCCGCCGAGCGCATCACCCTC
XM_005256502.1      GATGAGGAAGAGACTCCCTACCTGGTGAAGATCCCTGTCCCCGCCGAGCGCATCACCCTC
NM_004422.2         GATGAGGAAGAGACTCCCTACCTGGTGAAGATCCCTGTCCCCGCCGAGCGCATCACCCTC
NM_004423.3         GATGGGCAGGAGACGCCGTACCTTGTGAAGCTGCCCCTGCCCGCCGAGCGCGTCACCTTG
                    ****.* *.***** ** ***** ******.* **  * ************.***** * 

HsCD00002486        GGCGATTTCAAGAGCGTCCTGCAGCGGCCCGCGGGCGCCAAGTACTTTTTCAAGTCTATG
XM_005256502.1      GGCGATTTCAAGAGCGTCCTGCAGCGGCCCGCGGGCGCCAAGTACTTTTTCAAGTCTATG
NM_004422.2         GGCGATTTCAAGAGCGTCCTGCAGCGGCCCGCGGGCGCCAAGTACTTTTTCAAGTCTATG
NM_004423.3         GCGGACTTTAAGGGCGTTTTGCAGCGACCCAG---CTATAAGTTCTTCTTCAAGTCTATG
                    *  ** ** ***.****  *******.***.    * . ****:*** ************

HsCD00002486        GATCAGGATTTCGGGGTGGTGAAGGAAGAAATTTCAGATGACAACGCCCGCCTCCCCTGC
XM_005256502.1      GATCAGGATTTCGGGGTGGTGAAGGAAGAAATTTCAGATGACAACGCCCGCCTCCCCTGC
NM_004422.2         GATCAGGATTTCGGGGTGGTGAAGGAAGAAATTTCAGATGACAACGCCCGCCTCCCCTGC
NM_004423.3         GACGACGATTTCGGAGTGGTGAAGGAGGAGATCTCGGATGACAATGCCAAGCTACCATGC
                    **  * ********.***********.**.** **.******** ***.. **.**.***

HsCD00002486        TTCAACGGAAGGGTGGTATCCTGGCTGGTGTCCTCAGATAATCCCCAACCCGAGATGGCC
XM_005256502.1      TTCAACGGAAGGGTGGTATCCTGGCTGGTGTCCTCAGATAATCCCCAACCCGAGATGGCC
NM_004422.2         TTCAACGGAAGGGTGGTATCCTGGCTGGTGTCCTCAGATAATCCCCAACCCGAGATGGCC
NM_004423.3         TTCAATGGCCGGGTGGTGTCCTGGCTGGTGTCAGCTGAGGGCTCACACCCAGACCCAGCC
                    ***** **..*******.**************. *:** ..  *.**.**.** . .***

HsCD00002486        CCTCCAGTCCATGAGCCTCGGGCAGAACTGGCGCCTCCAGCCCCACCTTTACCTCCTTTG
XM_005256502.1      CCTCCAGTCCATGAGCCTCGGGCAGAACTGGCGCCTCCAGCCCCACCTTTACCTCCTTTG
NM_004422.2         CCTCCAGTCCATGAGCCTCGGGCAGAACTGGCGCCTCCAGCCCCACCTTTACCTCCTTTG
NM_004423.3         CCCTTCTGTGCTGATAACCCATCGGAGCTG------------------------CCACCA
                    **   .    .*** .. * . *.**.***                        **:  .

HsCD00002486        CCACCCGAGAGGACCAGCGGCATTGGGGACTCAAGGCCTCCATCCTTCCACCCTAATGTG
XM_005256502.1      CCACCCGAGAGGACCAGCGGCATTGGGGACTCAAGGCCTCCATCCTTCCACCCTAATGTG
NM_004422.2         CCACCCGAGAGGACCAGCGGCATTGGGGACTCAAGGCCTCCATCCTTCCACCCTAATGTG
NM_004423.3         CCTATGGAGCGCACGGGAGGCATCGGGGACTCCCGACCCCCATCCTTCCACCCTCATGCT
                    **:.  ***.* ** .*.***** ********..*.** ***************.***  

HsCD00002486        ---TCCAGCAGCCATGAGAATCTGGAGCCTGAGACAGAAACCGAGTCAGTAGTGTCACTG
XM_005256502.1      ---TCCAGCAGCCATGAGAATCTGGAGCCTGAGACAGAAACCGAGTCAGTAGTGTCACTG
NM_004422.2         ---TCCAGCAGCCATGAGAATCTGGAGCCTGAGACAGAAACCGAGTCAGTAGTGTCACTG
NM_004423.3         GGTGGGGGCAGCCAGGAGAACCTGGACAATGACACAGAGACGGACTCTTTGGTGTCTGCC
                          .******* ***** ***** ..*** *****.** ** **: *.*****:   

HsCD00002486        AGGCGGGAGCGGCCTCGCAGGAGAGACAGCAGTGAGCATGGCGCTGGGGGCCACAGGACT
XM_005256502.1      AGGCGGGAGCGGCCTCGCAGGAGAGACAGCACTGG------------GGGCCACAGGACT
NM_004422.2         AGGCGGGAGCGGCCTCGCAGGAGAGACAGCAGTGAGCATGGCGCTGGGGGCCACAGGACT
NM_004423.3         CAGCGAGAGCGGCCACGCCGGAGGGATGGCCCAGAGCATGCAACCCGGCTAAATGGAACT
                    ..***.********:***.****.** .**. :*.            *  ..* .*.***

HsCD00002486        GGTGGCCCCTCAAGGCTGGAGCGCCACCTGGCCGGATACGAGAGCTCCTCTACCCTCATG
XM_005256502.1      GGTGGCCCCTCAAGGCTGGAGCGCCACCTGGCCGGATACGAGAGCTCCTCTACCCTCATG
NM_004422.2         GGTGGCCCCTCAAGGCTGGAGCGCCACCTGGCCGGATACGAGAGCTCCTCTACCCTCATG
NM_004423.3         GCGAAGGGGGAACGGCGG---CGAGAACCAGGGGGTTATGATAGCTCATCCACCCTTATG
                    *  ..     .*.*** *   **. *.* .*  **:** ** *****.** ***** ***

HsCD00002486        ACCAGCGAGCTGGAGAGTACCAGCCTGGGGGACTCGGACGAGGAGGACACCATGAGCAGG
XM_005256502.1      ACCAGCGAGCTGGAGAGTACCAGCCTGGGGGACTCGGACGAGGAGGACACCATGAGCAGG
NM_004422.2         ACCAGCGAGCTGGAGAGTACCAGCCTGGGGGACTCGGACGAGGAGGACACCATGAGCAGG
NM_004423.3         AGCAGTGAGCTGGAGACCACCAGCTTCTTTGACTCAGATGAGGATGACTCCACCAGCAGG
                    * *** **********  ****** *    *****.** ***** ***:***  ******

HsCD00002486        TTCAGCAGCTCCACGGAGCAGAGCAGTGCCTCCCGCCTCCTTAAGCGCCACCGGCGGCGA
XM_005256502.1      TTCAGCAGCTCCACGGAGCAGAGCAGTGCCTCCCGCCTCCTTAAGCGCCACCGGCGGCGA
NM_004422.2         TTCAGCAGCTCCACGGAGCAGAGCAGTGCCTCCCGCCTCCTTAAGCGCCACCGGCGGCGA
NM_004423.3         TTCAGCAGCTCCACAGAACAGAGCAGTGCCTCACGCCTGATGAGAAGACACAAGCGGCGG
                    **************.**.**************.***** .* *...*.***..******.

HsCD00002486        AG---GAAGCAGAGGCCACCCCGCCTGGAGAGGACGTCATCCTTCAGCAGCGTCACAGAT
XM_005256502.1      AG---GAAGCAGAGGCCACCCCGCCTGGAGAGGACGTCATCCTTCAGCAGCGTCACAGAT
NM_004422.2         AG---GAAGCAGAGGCCACCCCGCCTGGAGAGGACGTCATCCTTCAGCAGCGTCACAGAT
NM_004423.3         CGGCGGAAGCAGAAGGTTTCTCGGATTGAGCGGTCCTCGTCCTTCAGCAGCATCACGGAC
                    .*   ********.*  : * ** .* ***.**:* **.************.****.** 

HsCD00002486        TCCACAATGTCTCTCAATATCATCACAGTCACGCTAAACATGGAGAAGTACAACTTCCTG
XM_005256502.1      TCCACAATGTCTCTCAATATCATCACAGTCACGCTAAACATGGAGAAGTACAACTTCCTG
NM_004422.2         TCCACAATGTCTCTCAATATCATCACAGTCACGCTAAACATGGAGAAGTACAACTTCCTG
NM_004423.3         TCCACCATGTCACTCAACATCATCACGGTCACTCTCAACATGGAAAAATATAACTTCTTG
                    *****.*****:***** ********.***** **.********.**.** ****** **

HsCD00002486        GGTATCTCCATTGTTGGCCAGAGCAATGAGCGGGGAGACGGAGGCATCTACATTGGCTCC
XM_005256502.1      GGTATCTCCATTGTTGGCCAGAGCAATGAGCGGGGAGACGGAGGCATCTACATTGGCTCC
NM_004422.2         GGTATCTCCATTGTTGGCCAGAGCAATGAGCGGGGAGACGGAGGCATCTACATTGGCTCC
NM_004423.3         GGCATCTCCATTGTGGGCCAAAGCAACGAGCGTGGTGACGGCGGCATCTACATTGGCTCT
                    ** *********** *****.***** ***** **:*****.***************** 

HsCD00002486        ATCATGAAGGGTGGGGCTGTGGCGGCCGACGGGCGCATTGAGCCAGGGGACATGCTTTTG
XM_005256502.1      ATCATGAAGGGTGGGGCTGTGGCGGCCGACGGGCGCATTGAGCCAGGGGACATGCTTTTG
NM_004422.2         ATCATGAAGGGTGGGGCTGTGGCGGCCGACGGGCGCATTGAGCCAGGGGACATGCTTTTG
NM_004423.3         ATCATGAAGGGTGGGGCCGTGGCTGCTGATGGACGCATCGAGCCAGGAGATATGTTGTTA
                    ***************** ***** ** ** **.***** ********.** *** * **.

HsCD00002486        CAGGTGAATGACATGAACTTTGAGAACATGAGCAACGATGACGCTGTGCGGGTGCTGAGG
XM_005256502.1      CAGGTGAATGACATGAACTTTGAGAACATGAGCAACGATGACGCTGTGCGGGTGCTGAGG
NM_004422.2         CAGGTGAATGACATGAACTTTGAGAACATGAGCAACGATGACGCTGTGCGGGTGCTGAGG
NM_004423.3         CAGGTAAACGAGATCAACTTTGAGAACATGAGTAATGACGATGCAGTCCGGGTACTGCGG
                    *****.** ** ** ***************** ** ** ** **:** *****.***.**

HsCD00002486        GACATTGTGCACAAGCCTGGCCCCATTGTGCTGACTGTGGCCAAGTGCTGGGATCCCTCT
XM_005256502.1      GACATTGTGCACAAGCCTGGCCCCATTGTGCTGACTGTGGCCAAGTGCTGGGATCCCTCT
NM_004422.2         GACATTGTGCACAAGCCTGGCCCCATTGTGCTGACTGTGGCCAAGTGCTGGGATCCCTCT
NM_004423.3         GAGATTGTGCACAAACCGGGGCCCATCACCCTGACTGTAGCCAAGTGCTGGGACCCAAGT
                    ** ***********.** ** ***** .  ********.************** **.: *

HsCD00002486        CCTCAGGCCTATTTCACTCTCCCCCGAAATGAGCCCATCCAGCCAATTGACCCTGCTGCC
XM_005256502.1      CCTCAGGCCTATTTCACTCTCCCCCGAAATGAGCCCATCCAGCCAATTGACCCTGCTGCC
NM_004422.2         CCTCAGGCCTATTTCACTCTCCCCCGAAATGAGCCCATCCAGCCAATTGACCCTGCTGCC
NM_004423.3         CCACGTGGTTGCTTCACATTGCCCAGGAGCGAGCCCATCCGGCCCATTGACCCTGCGGCC
                    **:*. *  *. *****: * ***.*.*. **********.***.*********** ***

HsCD00002486        TGGGTGTCCCATTCCGCGGCTCTGACTGGCACCTTCCCAGCCTATCCAGG----------
XM_005256502.1      TGGGTGTCCCATTCCGCGGCTCTGACTGGCACCTTCCCAGCCTATCCAGG----------
NM_004422.2         TGGGTGTCCCATTCCGCGGCTCTGACTGGCACCTTCCCAGCCTATCCAGG----------
NM_004423.3         TGGGTCTCCCACACTGCAGCCATGACCGGCACCTTCCCTGCATACGGCATGAGCCCCTCC
                    ***** ***** :* **.** .**** ***********:**.**   ..           

HsCD00002486        -----------TTCCTCCTCCATGAGCACCATTACATCTGGATCGTCTTTGCCTGATGGC
XM_005256502.1      -----------TTCCTCCTCCATGAGCACCATTACATCTGGATCGTCTTTGCCTGATGGC
NM_004422.2         -----------TTCCTCCTCCATGAGCACCATTACATCTGGATCGTCTTTGCCTGATGGC
NM_004423.3         CTGAGCACCATCACCTCCACCAGCTCCTCCATCACCAGTTCCATCCCTGACACAGAGCGC
                                :*****:***  : *:**** **.: *  .:   ** : .*:**  **

HsCD00002486        TGTGAAGGCCGGGGTCTCTCCGTCCATACGGACATGGCATCGGTGACCAAGGCCATGGCA
XM_005256502.1      TGTGAAGGCCGGGGTCTCTCCGTCCATACGGACATGGCATCGGTGACCAAGGCCATGGCA
NM_004422.2         TGTGAAGGCCGGGGTCTCTCCGTCCATACGGACATGGCATCGGTGACCAAGGCCATGGCA
NM_004423.3         CTAGACGACTTCCACTTGTCCATCCACAGTGACATGGCTGCCATCGTAAAAGCCATGGCC
                      :**.*.*    .  * ***.**** *  ********: * .* . .**.********.

HsCD00002486        GCTCCAGAGTCTGGACTGGAAGTCCGGGACCGCATGTGGCTCAAGATCACCATCCCTAAT
XM_005256502.1      GCTCCAGAGTCTGGACTGGAAGTCCGGGACCGCATGTGGCTCAAGATCACCATCCCTAAT
NM_004422.2         GCTCCAGAGTCTGGACTGGAAGTCCGGGACCGCATGTGGCTCAAGATCACCATCCCTAAT
NM_004423.3         TCCCCTGAATCAGGGTTGGAGGTCCGTGACCGCATGTGGCTCAAGATTACCATCCCTAAT
                     * **:**.**:**. ****.***** ******************** ************

HsCD00002486        GCCTTTCTGGGCTCGGATGTGGTTGACTGGCTCTACCATCACGTGGAGGGCTTTCCTGAG
XM_005256502.1      GCCTTTCTGGGCTCGGATGTGGTTGACTGGCTCTACCATCACGTGGAGGGCTTTCCTGAG
NM_004422.2         GCCTTTCTGGGCTCGGATGTGGTTGACTGGCTCTACCATCACGTGGAGGGCTTTCCTGAG
NM_004423.3         GCTTTCATCGGCTCAGATGTGGTGGACTGGCTGTACCACAATGTGGAAGGCTTCACGGAC
                    ** ** .* *****.******** ******** ***** .* *****.***** .* ** 

HsCD00002486        CGGCGGGAGGCCCGCAAGTATGCCAGCGGGCTGCTCAAAGCAGGCCTGATCCGACACACC
XM_005256502.1      CGGCGGGAGGCCCGCAAGTATGCCAGCGGGCTGCTCAAAGCAGGCCTGATCCGACACACC
NM_004422.2         CGGCGGGAGGCCCGCAAGTATGCCAGCGGGCTGCTCAAAGCAGGCCTGATCCGACACACC
NM_004423.3         CGGAGGGAGGCCCGCAAGTATGCCAGCAACCTGCTGAAAGCTGGCTTCATCCGCCATACC
                    ***.***********************.. ***** *****:*** * *****.** ***

HsCD00002486        GTCAACAAGATCACCTTCTCTGAGCAGTGCTATTACGTCTTCGGAGACCTCAGTGGTGGC
XM_005256502.1      GTCAACAAGATCACCTTCTCTGAGCAGTGCTATTACGTCTTCGGAGACCTCAGTGGTGGC
NM_004422.2         GTCAACAAGATCACCTTCTCTGAGCAGTGCTATTACGTCTTCGGAGACCTCAGTGGTGGC
NM_004423.3         GTCAACAAGATCACCTTCTCCGAGCAGTGCTACTACATCTTCGGTGACCTCTGCG-----
                    ******************** *********** ***.*******:******:* *     

HsCD00002486        TGTGAGAGCTACCTAGTCAACCTGTCTCTCAATGACAACGATGGCTCCAGTGGGGCTTCA
XM_005256502.1      TGTGAGAGCTACCTAGTCAACCTGTCTCTCAATGACAACGATGGCTCCAGTGGGGCTTCA
NM_004422.2         TGTGAGAGCTACCTAGTCAACCTGTCTCTCAATGACAACGATGGCTCCAGTGGGGCTTCA
NM_004423.3         -------GCAACATGGCCAACCTGTCTCTCCACGATCACGATGGCTCCAGTGGCGCCTCT
                           **:**.*.* *************.* ** .**************** ** **:

HsCD00002486        GACCAGGATACCCTGGCTCCTCTGCCTGGGGCCACCCCCTGGCCCCTGCTGCCCACTTTC
XM_005256502.1      GACCAGGATACCCTGGCTCCTCTGCCTGGGGCCACCCCCTGGCCCCTGCTGCCCACTTTC
NM_004422.2         GACCAGGATACCCTGGCTCCTCTGCCTGGGGCCACCCCCTGGCCCCTGCTGCCCACTTTC
NM_004423.3         GACCAGGACACACTGGCCCCTTTGCCGCACCCGGGGGCCGCCCCTTGGCCCATGGCTTTC
                    ******** **.***** *** ****  .  * .   **   **   **  .  .*****

HsCD00002486        TCCTACCAATACCCTGCCCCACACCCCTACAGCCCGCAGCCTCCACCCTACCATGAGCTT
XM_005256502.1      TCCTACCAATACCCTGCCCCACACCCCTACAGCCCGCAGCCTCCACCCTACCATGAGCTT
NM_004422.2         TCCTACCAATACCCTGCCCCACACCCCTACAGCCCGCAGCCTCCACCCTACCATGAGCTT
NM_004423.3         CCGTACCAGTACCCGCCACCCCCGCACCCATACAACCCGCACCCGGGCTTCCCGGAGCTG
                     * *****.*****  *.**.*. *.* ..:.*.. *.**. **.  **:**. ***** 

HsCD00002486        TCATCTTACACCTATGGTGGGGGCAGTGCCAGCAGCCAGCATAGTGAGGGCAGCCGGAGC
XM_005256502.1      TCATCTTACACCTATGGTGGGGGCAGTGCCAGCAGCCAGCATAGTGAGGGCAGCCGGAGC
NM_004422.2         TCATCTTACACCTATGGTGGGGGCAGTGCCAGCAGCCAGCATAGTGAGGGCAGCCGGAGC
NM_004423.3         ---GGCTACAGCTACGGCGGGGGCAGCGCCAGCAGTCAGCACAGCGAAGGCAGTCGGAGC
                          **** *** ** ******** ******** ***** ** **.***** ******

HsCD00002486        AGTGGGTCGACACGGAGTGATGGGGGGGCAGGGCGCACGGGGAGGCCCGAGGAGCGGGCC
XM_005256502.1      AGTGGGTCGACACGGAGTGATGGGGGGGCAGGGCGCACGGGGAGGCCCGAGGAGCGGGCC
NM_004422.2         AGTGGGTCGACACGGAGTGATGGGGGGGCAGGGCGCACGGGGAGGCCCGAGGAGCGGGCC
NM_004423.3         AGTGGCTCCAACCGTAGCGGCAGCGATCGGAGGAAGGAGAAGGACCCGAAGGCCGGGGAC
                    ***** ** *..** ** *. .* *.   ..**.. ..*..*.. ** .***.  ***.*

HsCD00002486        CCCGAGTCCAAGTCCGGCAGTGGCAGTGAGTCTGAGCCCTCCAGCCGAGGGGGCAGCCTT
XM_005256502.1      CCCGAGTCCAAGTCCGGCAGTGGCAGTGAGTCTGAGCCCTCCAGCCGAGGGGGCAGCCTT
NM_004422.2         CCCGAGTCCAAGTCCGGCAGTGGCAGTGAGTCTGAGCCCTCCAGCCGAGGGGGCAGCCTT
NM_004423.3         TCCAAGTCCGGGGGCAGCGGCAGCGAATCGGACCACACCACACGCAGCAGCCTGCGGGGG
                     **.*****..*  *.**.* .**..: .* .  * .**:*..**.*..*    .*    

HsCD00002486        CGGCGGGGTGGGGAAGCAAGTGGGACTAGCGATGGGGGCCCTCCTCCATCCAGAGGCTCA
XM_005256502.1      CGGCGGGGTGGGGAAGCAAGTGGGACTAGCGATGGGGGCCCTCCTCCATCCAGAGGCTCA
NM_004422.2         CGGCGGGGTGGGGAAGCAAGTGGGACTAGCGATGGGGGCCCTCCTCCATCCAGAGGCTCA
NM_004423.3         CCGCGGGAGCGGGCGCCCAGCG-----AGCGCTCAGGGCCGGCGGCCAGCGAGCACAGCC
                    * *****.  ***.. *.** *     ****.* .*****  *  *** * **.. . *.

HsCD00002486        ACTGGGGGTGCCCCTAATCTCCGAGCCCACCCAGGGCTCCATCCCTATGGACCGCCCCCT
XM_005256502.1      ACTGGGGGTGCCCCTAATCTCCGAGCCCACCCAGGGCTCCATCCCTATGGACCGCCCCCT
NM_004422.2         ACTGGGGGTGCCCCTAATCTCCGAGCCCACCCAGGGCTCCATCCCTATGGACCGCCCCCT
NM_004423.3         ACCGCAGCCACCATTCCCTGGCCAGCAGCCTTCG-------CAGCCACCACACACACCCG
                    ** * .*  .**. *..    * ***. .*  .*        . * *  ...*.*.*** 

HsCD00002486        GGCATGGCCCTCCCCTACAACCCCATGATGGTGGTCATGATGCCCCCACCTCCACCTCCA
XM_005256502.1      GGCATGGCCCTCCCCTACAACCCCATGATGGTGGTCATGATGCCCCCACCTCCACCTCCA
NM_004422.2         GGCATGGCCCTCCCCTACAACCCCATGATGGTGGTCATGATGCCCCCACCTCCACCTCCA
NM_004423.3         AGCTACGGTCCTCCCGGAGTGCCCCCTCTCTACGGCCCCCCCATGCTGATGATGCCCCCG
                    .**:: *  *  *** ...: ***.  .*  : * *.  .  .  * ..  . .** **.

HsCD00002486        GTCCCTCCAGCAGTGCAGCCTCCGGGGGCCCCTCCAGTCAGAGACCTGGGCTCTGTGCCC
XM_005256502.1      GTCCCTCCAGCAGTGCAGCCTCCGGGGGCCCCTCCAGTCAGAGACCTGGGCTCTGTGCCC
NM_004422.2         GTCCCTCCAGCAGTGCAGCCTCCGGGGGCCCCTCCAGTCAGAGACCTGGGCTCTGTGCCC
NM_004423.3         CCGCCCGCGGCCATGGGGCCCCCAGGAGCCCCTCCGGGCCGCGACCTGGCCTCAGTGCCC
                       **  *.**..** .*** **.**.********.* *.*.******* ***:******

HsCD00002486        CCAGAACTGACAGCCAGCCGCCAAAGCTTCCACATGGCCATGGGCAATCCCAGCGAGTTC
XM_005256502.1      CCAGAACTGACAGCCAGCCGCCAAAGCTTCCACATGGCCATGGGCAATCCCAGCGAGTTC
NM_004422.2         CCAGAACTGACAGCCAGCCGCCAAAGCTTCCACATGGCCATGGGCAATCCCAGCGAGTTC
NM_004423.3         CCGGAACTGACCGCCAGCAGACAGTCCTTCCGCATGGCCATGGGAAACCCCAGTGAGTTC
                    **.********.******.*.**.: *****.************.** ***** ******

HsCD00002486        TTTGTGGATGTTATGTAG
XM_005256502.1      TTTGTGGATGTTATGTAG
NM_004422.2         TTTGTGGATGTTATGTAG
NM_004423.3         TTTGTGGATGTGATGTGA
                    *********** ****..

Pathways

NCI : Canonical Wnt signaling pathway
NCI : Degradation of beta catenin
NCI : Noncanonical Wnt signaling pathway
Panther : Alzheimer disease-presenilin pathway
Panther : Angiogenesis
Panther : Wnt signaling pathway
Reactome : Asymmetric localization of PCP proteins
Reactome : PCP/CE pathway
Reactome : Signal Transduction
Reactome : Signaling by Hippo
Reactome : Signaling by Wnt
Reactome : TCF dependent signaling in response to WNT
Reactome : WNT mediated activation of DVL
Reactome : WNT5A-dependent internalization of FZD4
Reactome : beta-catenin independent WNT signaling
Reactome : degradation of DVL
Reactome : disassembly of the destruction complex and recruitment of AXIN to the membrane
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Neural Crest Differentiation
WikiPathway : Notch Signaling Pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Clone

Cloning Information : 109599
HIP Master Clone ID : 85882
Original Clone ID : FLH109599.01X

Organism


TAX_ID : 9606
Species Specific ID: 1856

Genome

Chromosome : 17
Map Location : 17p13.1
Ensembl : ENSG00000004975

Reagents

Labome : DVL2-antibody