DNASU Plasmid Repository • 480.965.5697 | Email

PRKR (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  EIF2AK2
Gene Name:  eukaryotic translation initiation factor 2-alpha kinase 2
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH130081.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000025

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1656nts         Open reading frame : 1 to 1656
Reference Sequence Alignment

ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTCAGAAG
CAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTCAGGACCTCCACATGATAGGAGG
TTTACATTTCAAGTTATAATAGATGGAAGAGAATTTCCAGAAGGTGAAGGTAGATCAAAG
AAGGAAGCAAAAAATGCCGCAGCCAAATTAGCTGTTGAGATACTTAATAAGGAAAAGAAG
GCAGTTAGTCCTTTATTATTGACAACAACGAATTCTTCAGAAGGATTATCCATGGGGAAT
TACATAGGCCTTATCAATAGAATTGCCCAGAAGAAAAGACTAACTGTAAATTATGAACAG
TGTGCATCGGGGGTGCATGGGCCAGAAGGATTTCATTATAAATGCAAAATGGGACAGAAA
GAATATAGTATTGGTACAGGTTCTACTAAACAGGAAGCAAAACAATTGGCCGCTAAACTT
GCATATCTTCAGATATTATCAGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGT
TCTTTTGCTACTACGTGTGAGTCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTCT
GAATCATCATCTGAAGGTGACTTCTCAGCAGATACATCAGAGATAAATTCTAACAGTGAC
AGTTTAAACAGTTCTTCGTTGCTTATGAATGGTCTCAGAAATAATCAAAGGAAGGCAAAA
AGATCTTTGGCACCCAGATTTGACCTTCCTGACATGAAAGAAACAAAGTATACTGTGGAC
AAGAGGTTTGGCATGGATTTTAAAGAAATAGAATTAATTGGCTCAGGTGGATTTGGCCAA
GTTTTCAAAGCAAAACACAGAATTGACGGAAAGACTTACGTTATTAAACGTGTTAAATAT
AATAACGAGAAGGCGGAGCGTGAAGTAAAAGCATTGGCAAAACTTGATCATGTAAATATT
GTTCACTACAATGGCTGTTGGGATGGATTTGATTATGATCCTGAGACCAGTGATGATTCT
CTTGAGAGCAGTGATTATGATCCTGAGAACAGCAAAAATAGTTCAAGGTCAAAGACTAAG
TGCCTTTTCATCCAAATGGAATTCTGTGATAAAGGGACCTTGGAACAATGGATTGAAAAA
AGAAGAGGCGAGAAACTAGACAAAGTTTTGGCTTTGGAACTCTTTGAACAAATAACAAAA
GGGGTGGATTATATACATTCAAAAAAATTAATTCATAGAGATCTTAAGCCAAGTAATATA
TTCTTAGTAGATACAAAACAAGTAAAGATTGGAGACTTTGGACTTGTAACATCTCTGAAA
AATGATGGAAAGCGAACAAGGAGTAAGGGAACTTTGCGATACATGAGCCCAGAACAGATT
TCTTCGCAAGACTATGGAAAGGAAGTGGACCTCTACGCTTTGGGGCTAATTCTTGCTGAA
CTTCTTCATGTATGTGACACTGCTTTTGAAACATCAAAGTTTTTCACAGACCTACGGGAT
GGCATCATCTCAGATATATTTGATAAAAAAGAAAAAACTCTTCTACAGAAATTACTCTCA
AAGAAACCTGAGGATCGACCTAACACATCTGAAATACTAAGGACCTTGACTGTGTGGAAG
AAAAGCCCAGAGAAAAATGAACGACACACATGTGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2091
Start on reference sequence 436
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : EIF2AK2
Symbol Nomenclature : EIF2AK2
SYNONYM : EIF2AK1; PKR; PRKR
Designation : P1/eIF-2A protein kinase|double stranded RNA activated protein kinase|eIF-2A protein kinase 2|interferon-induced, double-stranded RNA-activated protein kinase|interferon-inducible elF2alpha kinase|p68 kinase|protein kinase, interferon-inducible double stranded RNA dependent|tyrosine-protein kinase EIF2AK2
Full Nomenclature : eukaryotic translation initiation factor 2-alpha kinase 2
GENEID : 5610
GI : 60824576
GenBank Accession : AY893648
HGNC : 9437
MIM : 176871
Target GenBank: NM_002759

 

Reference Sequence Alignment

  

HsCD00000025        ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTCAGAAG
NM_001135651.2      ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTCAGAAG
NM_002759.3         ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTCAGAAG
NM_001135652.2      ATGGCTGGTGATCTTTCAGCAGGTTTCTTCATGGAGGAACTTAATACATACCGTCAGAAG
                    ************************************************************

HsCD00000025        CAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTCAGGACCTCCACATGATAGGAGG
NM_001135651.2      CAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTCAGGACCTCCACATGATAGGAGG
NM_002759.3         CAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTCAGGACCTCCACATGATAGGAGG
NM_001135652.2      CAGGGAGTAGTACTTAAATATCAAGAACTGCCTAATTCAGGACCTCCACATGATAGGAGG
                    ************************************************************

HsCD00000025        TTTACATTTCAAGTTATAATAGATGGAAGAGAATTTCCAGAAGGTGAAGGTAGATCAAAG
NM_001135651.2      TTTACATTTCAAGTTATAATAGATGGAAGAGAATTTCCAGAAGGTGAAGGTAGATCAAAG
NM_002759.3         TTTACATTTCAAGTTATAATAGATGGAAGAGAATTTCCAGAAGGTGAAGGTAGATCAAAG
NM_001135652.2      TTTACATTTCAAGTTATAATAGATGGAAGAGAATTTCCAGAAGGTGAAGGTAGATCAAAG
                    ************************************************************

HsCD00000025        AAGGAAGCAAAAAATGCCGCAGCCAAATTAGCTGTTGAGATACTTAATAAGGAAAAGAAG
NM_001135651.2      AAGGAAGCAAAAAATGCCGCAGCCAAATTAGCTGTTGAGATACTTAATAAGGAAAAGAAG
NM_002759.3         AAGGAAGCAAAAAATGCCGCAGCCAAATTAGCTGTTGAGATACTTAATAAGGAAAAGAAG
NM_001135652.2      AAGGAAGCAAAAAATGCCGCAGCCAAATTAGCTGTTGAGATACTTAATAAGGAAAAGAAG
                    ************************************************************

HsCD00000025        GCAGTTAGTCCTTTATTATTGACAACAACGAATTCTTCAGAAGGATTATCCATGGGGAAT
NM_001135651.2      GCAGTTAGTCCTTTATTATTGACAACAACGAATTCTTCAGAAGGATTATCCATGGGGAAT
NM_002759.3         GCAGTTAGTCCTTTATTATTGACAACAACGAATTCTTCAGAAGGATTATCCATGGGGAAT
NM_001135652.2      GCAGTTAGTCCTTTATTATTGACAACAACGAATTCTTCAGAAGGATTATCCATGGGGAAT
                    ************************************************************

HsCD00000025        TACATAGGCCTTATCAATAGAATTGCCCAGAAGAAAAGACTAACTGTAAATTATGAACAG
NM_001135651.2      TACATAGGCCTTATCAATAGAATTGCCCAGAAGAAAAGACTAACTGTAAATTATGAACAG
NM_002759.3         TACATAGGCCTTATCAATAGAATTGCCCAGAAGAAAAGACTAACTGTAAATTATGAACAG
NM_001135652.2      TACATAGGCCTTATCAATAGAATTGCCCAGAAGAAAAGACTAACTGTAAATTATGAACAG
                    ************************************************************

HsCD00000025        TGTGCATCGGGGGTGCATGGGCCAGAAGGATTTCATTATAAATGCAAAATGGGACAGAAA
NM_001135651.2      TGTGCATCGGGGGTGCATGGGCCAGAAGGATTTCATTATAAATGCAAAATGGGACAGAAA
NM_002759.3         TGTGCATCGGGGGTGCATGGGCCAGAAGGATTTCATTATAAATGCAAAATGGGACAGAAA
NM_001135652.2      TGTGCATCGGGGGTGCATGGGCCAGAAGGATTTCATTATAAATGCAAAATGGGACAGAAA
                    ************************************************************

HsCD00000025        GAATATAGTATTGGTACAGGTTCTACTAAACAGGAAGCAAAACAATTGGCCGCTAAACTT
NM_001135651.2      GAATATAGTATTGGTACAGGTTCTACTAAACAGGAAGCAAAACAATTGGCCGCTAAACTT
NM_002759.3         GAATATAGTATTGGTACAGGTTCTACTAAACAGGAAGCAAAACAATTGGCCGCTAAACTT
NM_001135652.2      GAATATAGTATTGGTACAGGTTCTACTAAACAGGAAGCAAAACAATTGGCCGCTAAACTT
                    ************************************************************

HsCD00000025        GCATATCTTCAGATATTATCAGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGT
NM_001135651.2      GCATATCTTCAGATATTATCAGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGT
NM_002759.3         GCATATCTTCAGATATTATCAGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGT
NM_001135652.2      GCATATCTTCAGATATTATCAGAAGAAACCTCAGTGAAATCTGACTACCTGTCCTCTGGT
                    ************************************************************

HsCD00000025        TCTTTTGCTACTACGTGTGAGTCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTCT
NM_001135651.2      TCTTTTGCTACTACGTGTGAGTCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTCT
NM_002759.3         TCTTTTGCTACTACGTGTGAGTCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTCT
NM_001135652.2      TCTTTTGCTACTACGTGTGAGTCCCAAAGCAACTCTTTAGTGACCAGCACACTCGCTTCT
                    ************************************************************

HsCD00000025        GAATCATCATCTGAAGGTGACTTCTCAGCAGATACATCAGAGATAAATTCTAACAGTGAC
NM_001135651.2      GAATCATCATCTGAAGGTGACTTCTCAGCAGATACATCAGAGATAAATTCTAACAGTGAC
NM_002759.3         GAATCATCATCTGAAGGTGACTTCTCAGCAGATACATCAGAGATAAATTCTAACAGTGAC
NM_001135652.2      GAATCATCATCTGAAGGTGACTTCTCAGCAGATACATCAGAGATAAATTCTAACAGTGAC
                    ************************************************************

HsCD00000025        AGTTTAAACAGTTCTTCGTTGCTTATGAATGGTCTCAGAAATAATCAAAGGAAGGCAAAA
NM_001135651.2      AGTTTAAACAGTTCTTCGTTGCTTATGAATGGTCTCAGAAATAATCAAAGGAAGGCAAAA
NM_002759.3         AGTTTAAACAGTTCTTCGTTGCTTATGAATGGTCTCAGAAATAATCAAAGGAAGGCAAAA
NM_001135652.2      AGTTTAAACAGTTCTTCGTTGCTTATGAATGGTCTCAGAAATAATCAAAGGAAGGCAAAA
                    ************************************************************

HsCD00000025        AGATCTTTGGCACCCAGATTTGACCTTCCTGACATGAAAGAAACAAAGTATACTGTGGAC
NM_001135651.2      AGATCTTTGGCACCCAGATTTGACCTTCCTGACATGAAAGAAACAAAGTATACTGTGGAC
NM_002759.3         AGATCTTTGGCACCCAGATTTGACCTTCCTGACATGAAAGAAACAAAGTATACTGTGGAC
NM_001135652.2      AGATCTTTGGCACCCAGATTTGACCTTCCTGACATGAAAGAAACAAAGTATACTGTGGAC
                    ************************************************************

HsCD00000025        AAGAGGTTTGGCATGGATTTTAAAGAAATAGAATTAATTGGCTCAGGTGGATTTGGCCAA
NM_001135651.2      AAGAGGTTTGGCATGGATTTTAAAGAAATAGAATTAATTGGCTCAGGTGGATTTGGCCAA
NM_002759.3         AAGAGGTTTGGCATGGATTTTAAAGAAATAGAATTAATTGGCTCAGGTGGATTTGGCCAA
NM_001135652.2      AAGAG-------------------------------------------------------
                    *****                                                       

HsCD00000025        GTTTTCAAAGCAAAACACAGAATTGACGGAAAGACTTACGTTATTAAACGTGTTAAATAT
NM_001135651.2      GTTTTCAAAGCAAAACACAGAATTGACGGAAAGACTTACGTTATTAAACGTGTTAAATAT
NM_002759.3         GTTTTCAAAGCAAAACACAGAATTGACGGAAAGACTTACGTTATTAAACGTGTTAAATAT
NM_001135652.2      ------------------------------------------------------------
                                                                                

HsCD00000025        AATAACGAGAAGGCGGAGCGTGAAGTAAAAGCATTGGCAAAACTTGATCATGTAAATATT
NM_001135651.2      AATAACGAGAAGGCGGAGCGTGAAGTAAAAGCATTGGCAAAACTTGATCATGTAAATATT
NM_002759.3         AATAACGAGAAGGCGGAGCGTGAAGTAAAAGCATTGGCAAAACTTGATCATGTAAATATT
NM_001135652.2      --------GAAGGCGGAGCGTGAAGTAAAAGCATTGGCAAAACTTGATCATGTAAATATT
                            ****************************************************

HsCD00000025        GTTCACTACAATGGCTGTTGGGATGGATTTGATTATGATCCTGAGACCAGTGATGATTCT
NM_001135651.2      GTTCACTACAATGGCTGTTGGGATGGATTTGATTATGATCCTGAGACCAGTGATGATTCT
NM_002759.3         GTTCACTACAATGGCTGTTGGGATGGATTTGATTATGATCCTGAGACCAGTGATGATTCT
NM_001135652.2      GTTCACTACAATGGCTGTTGGGATGGATTTGATTATGATCCTGAGACCAGTGATGATTCT
                    ************************************************************

HsCD00000025        CTTGAGAGCAGTGATTATGATCCTGAGAACAGCAAAAATAGTTCAAGGTCAAAGACTAAG
NM_001135651.2      CTTGAGAGCAGTGATTATGATCCTGAGAACAGCAAAAATAGTTCAAGGTCAAAGACTAAG
NM_002759.3         CTTGAGAGCAGTGATTATGATCCTGAGAACAGCAAAAATAGTTCAAGGTCAAAGACTAAG
NM_001135652.2      CTTGAGAGCAGTGATTATGATCCTGAGAACAGCAAAAATAGTTCAAGGTCAAAGACTAAG
                    ************************************************************

HsCD00000025        TGCCTTTTCATCCAAATGGAATTCTGTGATAAAGGGACCTTGGAACAATGGATTGAAAAA
NM_001135651.2      TGCCTTTTCATCCAAATGGAATTCTGTGATAAAGGGACCTTGGAACAATGGATTGAAAAA
NM_002759.3         TGCCTTTTCATCCAAATGGAATTCTGTGATAAAGGGACCTTGGAACAATGGATTGAAAAA
NM_001135652.2      TGCCTTTTCATCCAAATGGAATTCTGTGATAAAGGGACCTTGGAACAATGGATTGAAAAA
                    ************************************************************

HsCD00000025        AGAAGAGGCGAGAAACTAGACAAAGTTTTGGCTTTGGAACTCTTTGAACAAATAACAAAA
NM_001135651.2      AGAAGAGGCGAGAAACTAGACAAAGTTTTGGCTTTGGAACTCTTTGAACAAATAACAAAA
NM_002759.3         AGAAGAGGCGAGAAACTAGACAAAGTTTTGGCTTTGGAACTCTTTGAACAAATAACAAAA
NM_001135652.2      AGAAGAGGCGAGAAACTAGACAAAGTTTTGGCTTTGGAACTCTTTGAACAAATAACAAAA
                    ************************************************************

HsCD00000025        GGGGTGGATTATATACATTCAAAAAAATTAATTCATAGAGATCTTAAGCCAAGTAATATA
NM_001135651.2      GGGGTGGATTATATACATTCAAAAAAATTAATTCATAGAGATCTTAAGCCAAGTAATATA
NM_002759.3         GGGGTGGATTATATACATTCAAAAAAATTAATTCATAGAGATCTTAAGCCAAGTAATATA
NM_001135652.2      GGGGTGGATTATATACATTCAAAAAAATTAATTCATAGAGATCTTAAGCCAAGTAATATA
                    ************************************************************

HsCD00000025        TTCTTAGTAGATACAAAACAAGTAAAGATTGGAGACTTTGGACTTGTAACATCTCTGAAA
NM_001135651.2      TTCTTAGTAGATACAAAACAAGTAAAGATTGGAGACTTTGGACTTGTAACATCTCTGAAA
NM_002759.3         TTCTTAGTAGATACAAAACAAGTAAAGATTGGAGACTTTGGACTTGTAACATCTCTGAAA
NM_001135652.2      TTCTTAGTAGATACAAAACAAGTAAAGATTGGAGACTTTGGACTTGTAACATCTCTGAAA
                    ************************************************************

HsCD00000025        AATGATGGAAAGCGAACAAGGAGTAAGGGAACTTTGCGATACATGAGCCCAGAACAGATT
NM_001135651.2      AATGATGGAAAGCGAACAAGGAGTAAGGGAACTTTGCGATACATGAGCCCAGAACAGATT
NM_002759.3         AATGATGGAAAGCGAACAAGGAGTAAGGGAACTTTGCGATACATGAGCCCAGAACAGATT
NM_001135652.2      AATGATGGAAAGCGAACAAGGAGTAAGGGAACTTTGCGATACATGAGCCCAGAACAGATT
                    ************************************************************

HsCD00000025        TCTTCGCAAGACTATGGAAAGGAAGTGGACCTCTACGCTTTGGGGCTAATTCTTGCTGAA
NM_001135651.2      TCTTCGCAAGACTATGGAAAGGAAGTGGACCTCTACGCTTTGGGGCTAATTCTTGCTGAA
NM_002759.3         TCTTCGCAAGACTATGGAAAGGAAGTGGACCTCTACGCTTTGGGGCTAATTCTTGCTGAA
NM_001135652.2      TCTTCGCAAGACTATGGAAAGGAAGTGGACCTCTACGCTTTGGGGCTAATTCTTGCTGAA
                    ************************************************************

HsCD00000025        CTTCTTCATGTATGTGACACTGCTTTTGAAACATCAAAGTTTTTCACAGACCTACGGGAT
NM_001135651.2      CTTCTTCATGTATGTGACACTGCTTTTGAAACATCAAAGTTTTTCACAGACCTACGGGAT
NM_002759.3         CTTCTTCATGTATGTGACACTGCTTTTGAAACATCAAAGTTTTTCACAGACCTACGGGAT
NM_001135652.2      CTTCTTCATGTATGTGACACTGCTTTTGAAACATCAAAGTTTTTCACAGACCTACGGGAT
                    ************************************************************

HsCD00000025        GGCATCATCTCAGATATATTTGATAAAAAAGAAAAAACTCTTCTACAGAAATTACTCTCA
NM_001135651.2      GGCATCATCTCAGATATATTTGATAAAAAAGAAAAAACTCTTCTACAGAAATTACTCTCA
NM_002759.3         GGCATCATCTCAGATATATTTGATAAAAAAGAAAAAACTCTTCTACAGAAATTACTCTCA
NM_001135652.2      GGCATCATCTCAGATATATTTGATAAAAAAGAAAAAACTCTTCTACAGAAATTACTCTCA
                    ************************************************************

HsCD00000025        AAGAAACCTGAGGATCGACCTAACACATCTGAAATACTAAGGACCTTGACTGTGTGGAAG
NM_001135651.2      AAGAAACCTGAGGATCGACCTAACACATCTGAAATACTAAGGACCTTGACTGTGTGGAAG
NM_002759.3         AAGAAACCTGAGGATCGACCTAACACATCTGAAATACTAAGGACCTTGACTGTGTGGAAG
NM_001135652.2      AAGAAACCTGAGGATCGACCTAACACATCTGAAATACTAAGGACCTTGACTGTGTGGAAG
                    ************************************************************

HsCD00000025        AAAAGCCCAGAGAAAAATGAACGACACACATGTGAC
NM_001135651.2      AAAAGCCCAGAGAAAAATGAACGACACACATGTTAG
NM_002759.3         AAAAGCCCAGAGAAAAATGAACGACACACATGTTAG
NM_001135652.2      AAAAGCCCAGAGAAAAATGAACGACACACATGTTAG
                    ********************************* * 

Pathways

NCI : Ceramide signaling pathway
NCI : PDGFR-beta signaling pathway
NCI : Signaling events mediated by TCPTP
Panther : Apoptosis signaling pathway
Reactome : Antiviral mechanism by IFN-stimulated genes
Reactome : Cytokine Signaling in Immune system
Reactome : Disease
Reactome : Host Interactions with Influenza Factors
Reactome : ISG15 antiviral mechanism
Reactome : Immune System
Reactome : Influenza Infection
Reactome : Inhibition of PKR
Reactome : Interferon Signaling
Reactome : NS1 Mediated Effects on Host Pathways
WikiPathway : Translation Factors
WikiPathway : Type II interferon signaling (IFNG)

Clone

Cloning Information : 130081
HIP Master Clone ID : 106230
Original Clone ID : FLH130081.01L

Organism


TAX_ID : 9606
Species Specific ID: 5610

Genome

Chromosome : 2
Map Location : 2p22-p21
Ensembl : ENSG00000055332

Reagents

Labome : PKR-antibody