DNASU Plasmid Repository • 480.965.5697 | Email

PSMB6 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PSMB6
Gene Name:  proteasome (prosome, macropain) subunit, beta type, 6
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH109852.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00002626

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 720nts         Open reading frame : 1 to 720
Reference Sequence Alignment

ATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCTTGGGGGCCGGAG
GCGTTCACTCCAGACTGGGAAAGCCGAGAAGTTTCCACTGGGACCACTATCATGGCCGTG
CAGTTTGACGGGGGCGTGGTTCTGGGGGCGGACTCCAGAACAACCACTGGGTCCTACATC
GCCAATCGAGTGACTGACAAGCTGACACCTATTCACGACCGCATTTTCTGCTGTCGCTCA
GGCTCAGCTGCTGATACCCAGGCAGTAGCTGATGCTGTCACCTACCAGCTCGGTTTCCAC
AGCATTGAACTGAATGAGCCTCCACTGGTCCACACAGCAGCCAGCCTCTTTAAGGAGATG
TGTTACCGATACCGGGAAGACCTGATGGCGGGAATCATCATCGCAGGCTGGGACCCTCAA
GAAGGAGGGCAGGTGTACTCAGTGCCTATGGGGGGTATGATGGTAAGGCAGTCCTTTGCC
ATTGGAGGCTCCGGGAGCTCCTACATCTATGGCTATGTTGATGCTACCTACCGGGAAGGC
ATGACCAAGGAAGAGTGTCTGCAATTCACTGCCAATGCTCTCGCTTTGGCCATGGAGCGG
GATGGCTCCAGTGGAGGAGTGATCCGCCTGGCAGCCATTGCAGAGTCAGGGGTAGAGCGG
CAAGTACTTTTGGGAGACCAGATACCCAAATTCGCCGTTGCCACTTTACCACCCGCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 750
Start on reference sequence 31
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PSMB6
Symbol Nomenclature : PSMB6
SYNONYM : DELTA; LMPY; Y
Designation : PSY large multifunctional protease Y|macropain delta chain|multicatalytic endopeptidase complex delta chain|proteasome catalytic subunit 1|proteasome delta chain|proteasome subunit Y|proteasome subunit beta type-6|proteasome subunit delta
Full Nomenclature : proteasome (prosome, macropain) subunit, beta type, 6
GENEID : 5694
GI : 60654880
GenBank Accession : AY889214
HGNC : 9543
MIM : 600307
Vega : OTTHUMG00000090777
Target GenBank: BC000835

 

Reference Sequence Alignment

  

HsCD00002626      ATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCTTGGGGGCCGGAG
NM_002798.2       ATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCTTGGGGGCCGGAG
                  ************************************************************

HsCD00002626      GCGTTCACTCCAGACTGGGAAAGCCGAGAAGTTTCCACTGGGACCACTATCATGGCCGTG
NM_002798.2       GCGTTCACTCCAGACTGGGAAAGCCGAGAAGTTTCCACTGGGACCACTATCATGGCCGTG
                  ************************************************************

HsCD00002626      CAGTTTGACGGGGGCGTGGTTCTGGGGGCGGACTCCAGAACAACCACTGGGTCCTACATC
NM_002798.2       CAGTTTGACGGGGGCGTGGTTCTGGGGGCGGACTCCAGAACAACCACTGGGTCCTACATC
                  ************************************************************

HsCD00002626      GCCAATCGAGTGACTGACAAGCTGACACCTATTCACGACCGCATTTTCTGCTGTCGCTCA
NM_002798.2       GCCAATCGAGTGACTGACAAGCTGACACCTATTCACGACCGCATTTTCTGCTGTCGCTCA
                  ************************************************************

HsCD00002626      GGCTCAGCTGCTGATACCCAGGCAGTAGCTGATGCTGTCACCTACCAGCTCGGTTTCCAC
NM_002798.2       GGCTCAGCTGCTGATACCCAGGCAGTAGCTGATGCTGTCACCTACCAGCTCGGTTTCCAC
                  ************************************************************

HsCD00002626      AGCATTGAACTGAATGAGCCTCCACTGGTCCACACAGCAGCCAGCCTCTTTAAGGAGATG
NM_002798.2       AGCATTGAACTGAATGAGCCTCCACTGGTCCACACAGCAGCCAGCCTCTTTAAGGAGATG
                  ************************************************************

HsCD00002626      TGTTACCGATACCGGGAAGACCTGATGGCGGGAATCATCATCGCAGGCTGGGACCCTCAA
NM_002798.2       TGTTACCGATACCGGGAAGACCTGATGGCGGGAATCATCATCGCAGGCTGGGACCCTCAA
                  ************************************************************

HsCD00002626      GAAGGAGGGCAGGTGTACTCAGTGCCTATGGGGGGTATGATGGTAAGGCAGTCCTTTGCC
NM_002798.2       GAAGGAGGGCAGGTGTACTCAGTGCCTATGGGGGGTATGATGGTAAGGCAGTCCTTTGCC
                  ************************************************************

HsCD00002626      ATTGGAGGCTCCGGGAGCTCCTACATCTATGGCTATGTTGATGCTACCTACCGGGAAGGC
NM_002798.2       ATTGGAGGCTCCGGGAGCTCCTACATCTATGGCTATGTTGATGCTACCTACCGGGAAGGC
                  ************************************************************

HsCD00002626      ATGACCAAGGAAGAGTGTCTGCAATTCACTGCCAATGCTCTCGCTTTGGCCATGGAGCGG
NM_002798.2       ATGACCAAGGAAGAGTGTCTGCAATTCACTGCCAATGCTCTCGCTTTGGCCATGGAGCGG
                  ************************************************************

HsCD00002626      GATGGCTCCAGTGGAGGAGTGATCCGCCTGGCAGCCATTGCAGAGTCAGGGGTAGAGCGG
NM_002798.2       GATGGCTCCAGTGGAGGAGTGATCCGCCTGGCAGCCATTGCAGAGTCAGGGGTAGAGCGG
                  ************************************************************

HsCD00002626      CAAGTACTTTTGGGAGACCAGATACCCAAATTCGCCGTTGCCACTTTACCACCCGCCTAG
NM_002798.2       CAAGTACTTTTGGGAGACCAGATACCCAAATTCGCCGTTGCCACTTTACCACCCGCCTGA
                  **********************************************************..

Pathways

Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of Securin
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : AUF1 (hnRNP D0) destabilizes mRNA
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of NF-kappaB in B cells
Reactome : Adaptive Immune System
Reactome : Antigen processing-Cross presentation
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Apoptosis
Reactome : Assembly of the pre-replicative complex
Reactome : Asymmetric localization of PCP proteins
Reactome : Autodegradation of Cdh1 by Cdh1:APC/C
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : CDK-mediated phosphorylation and removal of Cdc6
Reactome : CDT1 association with the CDC6:ORC:origin complex
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Cross-presentation of soluble exogenous antigens (endosomes)
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin E associated events during G1/S transition
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : Disease
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : ER-Phagosome pathway
Reactome : G1/S DNA Damage Checkpoints
Reactome : G1/S Transition
Reactome : Gene Expression
Reactome : HIV Infection
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : M Phase
Reactome : M/G1 Transition
Reactome : Metabolism
Reactome : Metabolism of RNA
Reactome : Metabolism of amino acids and derivatives
Reactome : Metabolism of mRNA
Reactome : Mitotic Anaphase
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Orc1 removal from chromatin
Reactome : PCP/CE pathway
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of Apoptosis
Reactome : Regulation of DNA replication
Reactome : Regulation of activated PAK-2p34 by proteasome mediated degradation
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Regulation of mitotic cell cycle
Reactome : Regulation of ornithine decarboxylase (ODC)
Reactome : Removal of licensing factors from origins
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
Reactome : SCF-beta-TrCP mediated degradation of Emi1
Reactome : Separation of Sister Chromatids
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Stabilization of p53
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
Reactome : TCF dependent signaling in response to WNT
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : Ubiquitin-dependent degradation of Cyclin D
Reactome : Ubiquitin-dependent degradation of Cyclin D1
Reactome : Vif-mediated degradation of APOBEC3G
Reactome : Vpu mediated degradation of CD4
Reactome : beta-catenin independent WNT signaling
Reactome : degradation of AXIN
Reactome : degradation of DVL
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Proteasome Degradation

Protein

UniProt : Q6IAT9
UniProt : P28072
HPRD : 02630

Clone

Cloning Information : 109852
HIP Master Clone ID : 86135
Original Clone ID : FLH109852.01X

Organism


TAX_ID : 9606
Species Specific ID: 5694

Genome

Chromosome : 17
Map Location : 17p13
Ensembl : ENSG00000142507

Reagents

Labome : PSMB6-antibody