DNASU Plasmid Repository • 480.965.5697 | Email

CDC42 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDC42
Gene Name:  cell division cycle 42
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH056790.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000264

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 576nts         Open reading frame : 1 to 576
Reference Sequence Alignment

ATGCAGACAATTAAGTGTGTTGTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTG
ATATCCTACACAACAAACAAATTTCCATCGGAATATGTACCGACTGTTTTTGACAACTAT
GCAGTCACAGTTATGATTGGTGGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGG
CAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTC
TGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAG
ATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGA
GATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAG
ACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTT
ACACAGAAAGGCCTAAAGAATGTATTTGACGAAGCAATATTGGCTGCCCTGGAGCCTCCA
GAACCGAAGAAGAGCCGCAGGTGTGTGCTGCTATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 645
Start on reference sequence 70
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDC42
Symbol Nomenclature : CDC42
SYNONYM : CDC42Hs; G25K
Designation : G25K GTP-binding protein|GTP binding protein, 25kDa|GTP-binding protein, 25kD|cell division control protein 42 homolog|dJ224A6.1.1 (cell division cycle 42 (GTP-binding protein, 25kD))|dJ224A6.1.2 (cell division cycle 42 (GTP-binding protein, 25kD))|growth-regulating protein|small GTP binding protein CDC42
Full Nomenclature : cell division cycle 42
GENEID : 998
Locus Tag : RP1-224A6.5
GI : 60825890
GenBank Accession : AY893701
HGNC : 1736
MIM : 116952
Vega : OTTHUMG00000002753
Target GenBank: NM_001791

 

Reference Sequence Alignment

  

HsCD00000264        ATGCAGACAATTAAGTGTGTTGTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTG
NM_001039802.1      ATGCAGACAATTAAGTGTGTTGTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTG
NM_044472.2         ATGCAGACAATTAAGTGTGTTGTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTG
NM_001791.3         ATGCAGACAATTAAGTGTGTTGTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTG
                    ************************************************************

HsCD00000264        ATATCCTACACAACAAACAAATTTCCATCGGAATATGTACCGACTGTTTTTGACAACTAT
NM_001039802.1      ATATCCTACACAACAAACAAATTTCCATCGGAATATGTACCGACTGTTTTTGACAACTAT
NM_044472.2         ATATCCTACACAACAAACAAATTTCCATCGGAATATGTACCGACTGTTTTTGACAACTAT
NM_001791.3         ATATCCTACACAACAAACAAATTTCCATCGGAATATGTACCGACTGTTTTTGACAACTAT
                    ************************************************************

HsCD00000264        GCAGTCACAGTTATGATTGGTGGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGG
NM_001039802.1      GCAGTCACAGTTATGATTGGTGGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGG
NM_044472.2         GCAGTCACAGTTATGATTGGTGGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGG
NM_001791.3         GCAGTCACAGTTATGATTGGTGGAGAACCATATACTCTTGGACTTTTTGATACTGCAGGG
                    ************************************************************

HsCD00000264        CAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTC
NM_001039802.1      CAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTC
NM_044472.2         CAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTC
NM_001791.3         CAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTC
                    ************************************************************

HsCD00000264        TGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAG
NM_001039802.1      TGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAG
NM_044472.2         TGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAG
NM_001791.3         TGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAGTGGGTGCCTGAG
                    ************************************************************

HsCD00000264        ATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGA
NM_001039802.1      ATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGA
NM_044472.2         ATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGA
NM_001791.3         ATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGA
                    ************************************************************

HsCD00000264        GATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAG
NM_001039802.1      GATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAG
NM_044472.2         GATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAG
NM_001791.3         GATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAG
                    ************************************************************

HsCD00000264        ACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTT
NM_001039802.1      ACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTT
NM_044472.2         ACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTT
NM_001791.3         ACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTT
                    ************************************************************

HsCD00000264        ACACAGAAAGGCCTAAAGAATGTATTTGACGAAGCAATATTGGCTGCCCTGGAGCCTCCA
NM_001039802.1      ACACAGAAAGGCCTAAAGAATGTATTTGACGAAGCAATATTGGCTGCCCTGGAGCCTCCA
NM_044472.2         ACACAGAGAGGTCTGAAGAATGTGTTTGATGAGGCTATCCTAGCTGCCCTCGAGCCTCCG
NM_001791.3         ACACAGAAAGGCCTAAAGAATGTATTTGACGAAGCAATATTGGCTGCCCTGGAGCCTCCA
                    *******.*** **.********.***** **.**:**. *.******** ********.

HsCD00000264        GAACCGAAGAAGAGCCGCAGGTGTGTGCTGCTATTG
NM_001039802.1      GAACCGAAGAAGAGCCGCAGGTGTGTGCTGCTATGA
NM_044472.2         GAAACTCAACCCAAAAGGAAGTGCTGTATATTCTAA
NM_001791.3         GAACCGAAGAAGAGCCGCAGGTGTGTGCTGCTATGA
                    ***.* .*... *...* *.***    .*. *.* .

Pathways

NCI : CDC42 signaling events
NCI : CXCR4-mediated signaling events
NCI : E-cadherin signaling in the nascent adherens junction
NCI : EPHB forward signaling
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : Integrin-linked kinase signaling
NCI : Internalization of ErbB1
NCI : Lissencephaly gene (LIS1) in neuronal migration and development
NCI : N-cadherin signaling events
NCI : Nectin adhesion pathway
NCI : Netrin-mediated signaling events
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Noncanonical Wnt signaling pathway
NCI : Nongenotropic Androgen signaling
NCI : Osteopontin-mediated events
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Regulation of CDC42 activity
NCI : Regulation of p38-alpha and p38-beta
NCI : RhoA signaling pathway
NCI : S1P4 pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : TCR signaling in naïve CD4+ T cells
Panther : Axon guidance mediated by Slit/Robo
Panther : Axon guidance mediated by netrin
Panther : Cytoskeletal regulation by Rho GTPase
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Integrin signalling pathway
Panther : Ras Pathway
Panther : T cell activation
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : CD28 co-stimulation
Reactome : CD28 dependent Vav1 pathway
Reactome : CDO in myogenesis
Reactome : Costimulation by the CD28 family
Reactome : DCC mediated attractive signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : EGFR downregulation
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : G alpha (12/13) signalling events
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Hemostasis
Reactome : Immune System
Reactome : Inactivation of Cdc42 and Rac
Reactome : Innate Immune System
Reactome : Myogenesis
Reactome : Netrin-1 signaling
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of actin dynamics for phagocytic cup formation
Reactome : Rho GTPase cycle
Reactome : Sema4D in semaphorin signaling
Reactome : Sema4D induced cell migration and growth-cone collapse
Reactome : Semaphorin interactions
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by GPCR
Reactome : Signaling by Rho GTPases
Reactome : Signaling by Robo receptor
WikiPathway : Androgen receptor signaling pathway
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Focal Adhesion
WikiPathway : G13 Signaling Pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TOR signaling
WikiPathway : angiogenesis overview
WikiPathway : p38 MAPK Signaling Pathway

Clone

Cloning Information : 56790
HIP Master Clone ID : 35078
Original Clone ID : FLH056790.01L

Organism


TAX_ID : 9606
Species Specific ID: 998

Genome

Chromosome : 1
Map Location : 1p36.1
Ensembl : ENSG00000070831

Reagents

Labome : cdc42-antibody