DNASU Plasmid Repository • 480.965.5697 | Email

TYMS (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TYMS
Gene Name:  thymidylate synthetase
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH110752.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00002793

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 942nts         Open reading frame : 1 to 942
Reference Sequence Alignment

ATGCCTGTGGCCGGCTCGGAGCTGCCGCGCCGGCCCTTGCCCCCCGCCGCACAGGAGCGG
GACGCCGAGCCGCGTCCGCCGCACGGGGAGCTGCAGTACCTGGGGCAGATCCAACACATC
CTCCGCTGCGGCGTCAGGAAGGACGACCGCACGGGCACCGGCACCCTGTCGGTATTCGGC
ATGCAGGCGCGCTACAGCCTGAGAGATGAATTCCCTCTGCTGACAACCAAACGTGTGTTC
TGGAAGGGTGTTTTGGAGGAGTTGCTGTGGTTTATCAAGGGATCCACAAATGCTAAAGAG
CTGTCTTCCAAGGGAGTGAAAATCTGGGATGCCAATGGATCCCGAGACTTTTTGGACAGC
CTGGGATTCTCCACCAGAGAAGAAGGGGACTTGGGCCCAGTTTATGGCTTCCAGTGGAGG
CATTTTGGGGCAGAATACAGAGATATGGAATCAGATTATTCAGGACAGGGAGTTGACCAA
CTGCAAAGAGTGATTGACACCATCAAAACCAACCCTGACGACAGAAGAATCATCATGTGC
GCTTGGAATCCAAGAGATCTTCCTCTGATGGCGCTGCCTCCATGCCATGCCCTCTGCCAG
TTCTATGTGGTGAACAGTGAGCTGTCCTGCCAGCTGTACCAGAGATCGGGAGACATGGGC
CTCGGTGTGCCTTTCAACATCGCCAGCTACGCCCTGCTCACGTACATGATTGCGCACATC
ACGGGCCTGAAGCCAGGTGACTTTATACACACTTTGGGAGATGCACATATTTACCTGAAT
CACATCGAGCCACTGAAAATTCAGCTTCAGCGAGAACCCAGACCTTTCCCAAAGCTCAGG
ATTCTTCGAAAAGTTGAGAAAATTGATGACTTCAAAGCTGAAGACTTTCAGATTGAAGGG
TACAATCCGCATCCAACTATTAAAATGGAAATGGCTGTTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1019
Start on reference sequence 78
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TYMS
Symbol Nomenclature : TYMS
SYNONYM : HST422; TMS; TS
Designation : TSase|thymidylate synthase
Full Nomenclature : thymidylate synthetase
GENEID : 7298
Locus Tag : OK/SW-cl.29
GI : 60655084
GenBank Accession : AY889315
HGNC : 12441
MIM : 188350
Vega : OTTHUMG00000131473
Target GenBank: BC002567

 

Reference Sequence Alignment

  

HsCD00002793      ATGCCTGTGGCCGGCTCGGAGCTGCCGCGCCGGCCCTTGCCCCCCGCCGCACAGGAGCGG
NM_001071.2       ATGCCTGTGGCCGGCTCGGAGCTGCCGCGCCGGCCCTTGCCCCCCGCCGCACAGGAGCGG
                  ************************************************************

HsCD00002793      GACGCCGAGCCGCGTCCGCCGCACGGGGAGCTGCAGTACCTGGGGCAGATCCAACACATC
NM_001071.2       GACGCCGAGCCGCGTCCGCCGCACGGGGAGCTGCAGTACCTGGGGCAGATCCAACACATC
                  ************************************************************

HsCD00002793      CTCCGCTGCGGCGTCAGGAAGGACGACCGCACGGGCACCGGCACCCTGTCGGTATTCGGC
NM_001071.2       CTCCGCTGCGGCGTCAGGAAGGACGACCGCACGGGCACCGGCACCCTGTCGGTATTCGGC
                  ************************************************************

HsCD00002793      ATGCAGGCGCGCTACAGCCTGAGAGATGAATTCCCTCTGCTGACAACCAAACGTGTGTTC
NM_001071.2       ATGCAGGCGCGCTACAGCCTGAGAGATGAATTCCCTCTGCTGACAACCAAACGTGTGTTC
                  ************************************************************

HsCD00002793      TGGAAGGGTGTTTTGGAGGAGTTGCTGTGGTTTATCAAGGGATCCACAAATGCTAAAGAG
NM_001071.2       TGGAAGGGTGTTTTGGAGGAGTTGCTGTGGTTTATCAAGGGATCCACAAATGCTAAAGAG
                  ************************************************************

HsCD00002793      CTGTCTTCCAAGGGAGTGAAAATCTGGGATGCCAATGGATCCCGAGACTTTTTGGACAGC
NM_001071.2       CTGTCTTCCAAGGGAGTGAAAATCTGGGATGCCAATGGATCCCGAGACTTTTTGGACAGC
                  ************************************************************

HsCD00002793      CTGGGATTCTCCACCAGAGAAGAAGGGGACTTGGGCCCAGTTTATGGCTTCCAGTGGAGG
NM_001071.2       CTGGGATTCTCCACCAGAGAAGAAGGGGACTTGGGCCCAGTTTATGGCTTCCAGTGGAGG
                  ************************************************************

HsCD00002793      CATTTTGGGGCAGAATACAGAGATATGGAATCAGATTATTCAGGACAGGGAGTTGACCAA
NM_001071.2       CATTTTGGGGCAGAATACAGAGATATGGAATCAGATTATTCAGGACAGGGAGTTGACCAA
                  ************************************************************

HsCD00002793      CTGCAAAGAGTGATTGACACCATCAAAACCAACCCTGACGACAGAAGAATCATCATGTGC
NM_001071.2       CTGCAAAGAGTGATTGACACCATCAAAACCAACCCTGACGACAGAAGAATCATCATGTGC
                  ************************************************************

HsCD00002793      GCTTGGAATCCAAGAGATCTTCCTCTGATGGCGCTGCCTCCATGCCATGCCCTCTGCCAG
NM_001071.2       GCTTGGAATCCAAGAGATCTTCCTCTGATGGCGCTGCCTCCATGCCATGCCCTCTGCCAG
                  ************************************************************

HsCD00002793      TTCTATGTGGTGAACAGTGAGCTGTCCTGCCAGCTGTACCAGAGATCGGGAGACATGGGC
NM_001071.2       TTCTATGTGGTGAACAGTGAGCTGTCCTGCCAGCTGTACCAGAGATCGGGAGACATGGGC
                  ************************************************************

HsCD00002793      CTCGGTGTGCCTTTCAACATCGCCAGCTACGCCCTGCTCACGTACATGATTGCGCACATC
NM_001071.2       CTCGGTGTGCCTTTCAACATCGCCAGCTACGCCCTGCTCACGTACATGATTGCGCACATC
                  ************************************************************

HsCD00002793      ACGGGCCTGAAGCCAGGTGACTTTATACACACTTTGGGAGATGCACATATTTACCTGAAT
NM_001071.2       ACGGGCCTGAAGCCAGGTGACTTTATACACACTTTGGGAGATGCACATATTTACCTGAAT
                  ************************************************************

HsCD00002793      CACATCGAGCCACTGAAAATTCAGCTTCAGCGAGAACCCAGACCTTTCCCAAAGCTCAGG
NM_001071.2       CACATCGAGCCACTGAAAATTCAGCTTCAGCGAGAACCCAGACCTTTCCCAAAGCTCAGG
                  ************************************************************

HsCD00002793      ATTCTTCGAAAAGTTGAGAAAATTGATGACTTCAAAGCTGAAGACTTTCAGATTGAAGGG
NM_001071.2       ATTCTTCGAAAAGTTGAGAAAATTGATGACTTCAAAGCTGAAGACTTTCAGATTGAAGGG
                  ************************************************************

HsCD00002793      TACAATCCGCATCCAACTATTAAAATGGAAATGGCTGTTTAG
NM_001071.2       TACAATCCGCATCCAACTATTAAAATGGAAATGGCTGTTTAG
                  ******************************************

Pathways

NCI : E2F transcription factor network
Panther : De novo pyrimidine deoxyribonucleotide biosynthesis
Panther : Formyltetrahydroformate biosynthesis
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : E2F mediated regulation of DNA replication
Reactome : G1/S Transition
Reactome : G1/S-Specific Transcription
Reactome : Metabolism
Reactome : Metabolism of nucleotides
Reactome : Mitotic G1-G1/S phases
Reactome : Pyrimidine biosynthesis
Reactome : Pyrimidine metabolism
WikiPathway : Epithelium TarBase
WikiPathway : Fluoropyrimidine Activity
WikiPathway : Leukocyte TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : One Carbon Metabolism

Protein

UniProt : P04818
UniProt : Q53Y97
HPRD : 01774

Clone

Cloning Information : 110752
HIP Master Clone ID : 87035
Original Clone ID : FLH110752.01X

Organism


TAX_ID : 9606
Species Specific ID: 7298

Genome

Chromosome : 18
Map Location : 18p11.32
Ensembl : ENSG00000176890

Reagents

Labome : TYMS-antibody