DNASU Plasmid Repository • 480.965.5697 | Email

SOD1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SOD1
Gene Name:  superoxide dismutase 1, soluble
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH023282.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00002824

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 465nts         Open reading frame : 1 to 465
Reference Sequence Alignment

ATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATCAAT
TTCGAGCAGAAGGAAAGTAATGGACCAGTGAAGGTGTGGGGAAGCATTAAAGGACTGACT
GAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAGCAGGCTGTACCAGT
GCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGGATGAAGAGAGG
CATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATGTGTCTATT
GAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTGGTC
CATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAAC
GCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 532
Start on reference sequence 68
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SOD1
Symbol Nomenclature : SOD1
SYNONYM : ALS; ALS1; HEL-S-44; IPOA; SOD; hSod1; homodimer
Designation : Cu/Zn superoxide dismutase|SOD, soluble|epididymis secretory protein Li 44|indophenoloxidase A|superoxide dismutase [Cu-Zn]|superoxide dismutase, cystolic
Full Nomenclature : superoxide dismutase 1, soluble
GENEID : 6647
GI : 61371882
GenBank Accession : AY891822
HGNC : 11179
MIM : 147450
Vega : OTTHUMG00000084878
Target GenBank: BC001034

 

Reference Sequence Alignment

  

HsCD00002824      ATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATCAAT
NM_000454.4       ATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATCAAT
                  ************************************************************

HsCD00002824      TTCGAGCAGAAGGAAAGTAATGGACCAGTGAAGGTGTGGGGAAGCATTAAAGGACTGACT
NM_000454.4       TTCGAGCAGAAGGAAAGTAATGGACCAGTGAAGGTGTGGGGAAGCATTAAAGGACTGACT
                  ************************************************************

HsCD00002824      GAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAGCAGGCTGTACCAGT
NM_000454.4       GAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAGCAGGCTGTACCAGT
                  ************************************************************

HsCD00002824      GCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGGATGAAGAGAGG
NM_000454.4       GCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGGATGAAGAGAGG
                  ************************************************************

HsCD00002824      CATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATGTGTCTATT
NM_000454.4       CATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATGTGTCTATT
                  ************************************************************

HsCD00002824      GAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTGGTC
NM_000454.4       GAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTGGTC
                  ************************************************************

HsCD00002824      CATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAAC
NM_000454.4       CATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAAC
                  ************************************************************

HsCD00002824      GCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATTG
NM_000454.4       GCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAA
                  *******************************************:.

Pathways

NCI : FOXA1 transcription factor network
NCI : Validated nuclear estrogen receptor alpha network
Reactome : Cellular responses to stress
Reactome : Detoxification of Reactive Oxygen Species
Reactome : Hemostasis
Reactome : Platelet activation, signaling and aggregation
Reactome : Platelet degranulation
Reactome : Response to elevated platelet cytosolic Ca2+
WikiPathway : Folate Metabolism
WikiPathway : Oxidative Stress
WikiPathway : Selenium Pathway
WikiPathway : Vitamin B12 Metabolism

Protein

UniProt : P00441
HPRD : 00937

Clone

Cloning Information : 23282
HIP Master Clone ID : 53658
Original Clone ID : FLH023282.01L

Organism


TAX_ID : 9606
Species Specific ID: 6647

Genome

Chromosome : 21
Map Location : 21q22.11
Ensembl : ENSG00000142168