DNASU Plasmid Repository • 480.965.5697 | Email

CFTR (Homo sapiens) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CFTR
Gene Name:  cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Sequence             
Original Clone ID: 2935c97BCt5b1
Keyword: Partial Protein, NBD1 domain
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX3               Format:  FUSION
Source: SGX Pharmaceuticals, Inc.
Description: This clone encodes the NBD1 domain and corresponds to region 383-678 on full length protein NP_000483.3.
Comments: C-terminal 6-His, TOPO. Insert sequence of this clone was provided by clone submitter and was not fully sequence verified.
Mutation/
Discrepancy :
No / Unknown
Publications: None
Authors: SGX Pharmaceuticals, Inc.
HsCD00287547

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 912nts        
Open reading frame : 1 to 912
Reference Sequence Alignment

GAATATAATCTGACGACTACCGAAGTTGTTATGGAAAACGTGACGGCCTTCTGGGAAGAA
GGCTTCGGTGAACTTTTCGAAAAAGCGAAGCAGAATAACAACAACCGCAAAACCTCCAAC
GGGGATGATAGCTTGTTCTTTAGCAACTTTTCACTGCTGGGTACGCCGGTCTTAAAAGAT
ATCAATTTTAAAATTGAACGCGGTCAGTTGCTTGCCGTGGCCGGCTCAACAGGTGCCGGT
AAAACTTCTCTGTTGATGATGATCATGGGCGAACTGGAACCGAGCGAAGGCAAAATTAAA
CATAGTGGGCGCATCAGTTTCTGTAGTCAGTTCTCTTGGATTATGCCTGGTACCATTAAA
GAAAATATTATCTTTGGTGTGAGTTATGATGAATATCGTTATCGTAGCGTGATCAAAGCC
TGCCAGTTAGAAGAAGACATCTCGAAATTTGCGGAAAAGGATAATATTGTGTTAGGTGAA
GGTGGTATCACTTTATCGGGTGGTCAGCGCGCGCGCATTTCGCTGGCTCGTGCTGTTTAC
AAGGATGCAGATTTATATCTGTTGGATTCCCCTTTTGGCTATTTAGATGTGTTGACCGAG
AAAGAAATCTTCGAATCCTGTGTCTGTAAACTGATGGCTAATAAAACGCGTATTTTGGTC
ACCTCGAAAATGGAACATCTGAAGAAAGCAGACAAAATTCTGATTCTGAACGAAGGCAGC
AGTTATTTTTATGGCACATTCAGCGAACTGCAAAACCTGCAGCCAGATTTTTCCAGCAAG
TTAATGGGGTGCGATAGTTTCGATCAATTTAGCGCAGAACGCCGCAATAGTATTTTGACT
GAGACCCTGCACCGTTTCTCTTTAGAAGGCGACGCCCCAGTATCGGAAGGGCATCATCAC
CATCACCACTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: End read sequencing of cDNA insert
Reference Sequence Annotations:
Start on protein reference sequence 383
End on protein reference sequence 678
Mutations:
None
Discrepancy:
None
Others:
Termini 383-678
Domain NBD1
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Tested_Not_Purified
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in 2935c
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CFTR
Symbol Nomenclature : CFTR
SYNONYM : ABC35; ABCC7; CF; CFTR/MRP; MRP7; TNR-CFTR; dJ760C5.1
Designation : cAMP-dependent chloride channel|channel conductance-controlling ATPase|cystic fibrosis transmembrane conductance regulator
Full Nomenclature : cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
GENEID : 1080
Locus Tag : tcag7.78
GenBank Accession : NP_000483.3
HGNC : 1884
MIM : 602421
Vega : OTTHUMG00000023076
Target GenBank: NP_000483.3

 

Reference Sequence Alignment

  

HsCD00287547      ------------------------------------------------------------
NM_000492.3       ATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGCTGGACC
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       AGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACATATACCAAATC
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       CCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTGGAAAGAGAATGGGATAGAGAG
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       CTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAGA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       TTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTCACCAAAGCAGTACAGCCTCTC
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       TTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGAGGAACGCTCTATCGCG
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       ATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGACACTGCTCCTACACCCA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAATAGCTATGTTTAGTTTGATT
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       TATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTATTGGACAACTT
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGGACTTGCATTGGCACATTTC
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGGCTAATCTGGGAGTTGTTACAG
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTTGCCCTTTTTCAGGCTGGGCTA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GGGAGAATGATGATGAAGTACAGAGATCAGAGAGCTGGGAAGATCAGTGAAAGACTTGTG
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       ATTACCTCAGAAATGATTGAAAATATCCAATCTGTTAAGGCATACTGCTGGGAAGAAGCA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       ATGGAAAAAATGATTGAAAACTTAAGACAAACAGAACTGAAACTGACTCGGAAGGCAGCC
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       TATGTGAGATACTTCAATAGCTCAGCCTTCTTCTTCTCAGGGTTCTTTGTGGTGTTTTTA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       TCTGTGCTTCCCTATGCACTAATCAAAGGAATCATCCTCCGGAAAATATTCACCACCATC
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       TCATTCTGCATTGTTCTGCGCATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       TGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAGAATAT
                                                                              

HsCD00287547      ---------GAATATAATCTGACGACTACCGAAGTTGTTATGGAAAACGTGACGGCCTTC
NM_000492.3       AAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTC
                           ********  *.********.*****:** *****.** **.**.******

HsCD00287547      TGGGAAGAAGGCTTCGGTGAACTTTTCGAAAAAGCGAAGCAGAATAACAACAACCGCAAA
NM_000492.3       TGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAA
                  *****.**.**.** ** *** *:** **.*****.**.**.** ** ***** .*.***

HsCD00287547      ACCTCCAACGGGGATGATAGCTTGTTCTTTAGCAACTTTTCACTGCTGGGTACGCCGGTC
NM_000492.3       ACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTC
                  ** ** ** ** ***** *** * ***** ** ** ** ***** ** ***** ** ***

HsCD00287547      TTAAAAGATATCAATTTTAAAATTGAACGCGGTCAGTTGCTTGCCGTGGCCGGCTCAACA
NM_000492.3       CTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACT
                   *.******** ***** **.**:***.*.**:****** * ** ** ** **.**.**:

HsCD00287547      GGTGCCGGTAAAACTTCTCTGTTGATGATGATCATGGGCGAACTGGAACCGAGCGAAGGC
NM_000492.3       GGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGT
                  **:**.** **.*****:**  *.***.**** *****.********.** : .**.** 

HsCD00287547      AAAATTAAACATAGTGGGCGCATCAGTTTCTGTAGTCAGTTCTCTTGGATTATGCCTGGT
NM_000492.3       AAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGC
                  ********.** *****..*.** : :******: ****** ** ************** 

HsCD00287547      ACCATTAAAGAAAATATTATCTTTGGTGTGAGTTATGATGAATATCGTTATCGTAGCGTG
NM_000492.3       ACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTC
                  ***************** *********** :  ************.*:** .*:***** 

HsCD00287547      ATCAAAGCCTGCCAGTTAGAAGAAGACATCTCGAAATTTGCGGAAAAGGATAATATTGTG
NM_000492.3       ATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTT
                  ********.*****. *******.******** **.*****.**.**.** *****:** 

HsCD00287547      TTAGGTGAAGGTGGTATCACTTTATCGGGTGGTCAGCGCGCGCGCATTTCGCTGGCTCGT
NM_000492.3       CTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGA
                   *:**:********:*****: *.:  **:*****.**.**..*.*****  *.**:.*:

HsCD00287547      GCTGTTTACAAGGATGCAGATTTATATCTGTTGGATTCCCCTTTTGGCTATTTAGATGTG
NM_000492.3       GCAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGATGTT
                  **:**:*****.*****:*****.*** *.**.** ** ********.**  ******* 

HsCD00287547      TTGACCGAGAAAGAAATCTTCGAATCCTGTGTCTGTAAACTGATGGCTAATAAAACGCGT
NM_000492.3       TTAACAGAAAAAGAAATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAGG
                  **.**.**.********.** ***: ************************ ***** .* 

HsCD00287547      ATTTTGGTCACCTCGAAAATGGAACATCTGAAGAAAGCAGACAAAATTCTGATTCTGAAC
NM_000492.3       ATTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCAT
                  *********** ** ************ *.********:********: *.*** **.* 

HsCD00287547      GAAGGCAGCAGTTATTTTTATGGCACATTCAGCGAACTGCAAAACCTGCAGCCAGATTTT
NM_000492.3       GAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCCAGACTTT
                  ***** ***** *********** ***** : .***** ***** **.******** ***

HsCD00287547      TCCAGCAAGTTAATGGGGTGCGATAGTTTCGATCAATTTAGCGCAGAACGCCGCAATAGT
NM_000492.3       AGCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTGCAGAAAGAAGAAATTCA
                  : *: .**. *.*****.** ***: ****** ******** ******.*..*.***: :

HsCD00287547      ATTTTGACTGAGACCCTGCACCGTTTCTCTTTAGAAGGCGACGCCCCAGTATCGGAAGGG
NM_000492.3       ATCCTAACTGAGACCTTACACCGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTGGACA
                  **  *.********* *.***********:********.** ** **:**.**  ... .

HsCD00287547      CATCATCACCATCACCACTGA---------------------------------------
NM_000492.3       GAAACAAAAAAACAATCTTTTAAACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCT
                   *:..:.*..*:**. . * :                                       

HsCD00287547      ------------------------------------------------------------
NM_000492.3       ATTCTCAATCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACAA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       ATGAATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAGAAGGCTGTCCTTAGTACCA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GATTCTGAGCAGGGAGAGGCGATACTGCCTCGCATCAGCGTGATCAGCACTGGCCCCACG
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       CTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGT
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       CAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       AACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       AGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       CCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATT
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       TTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTG
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       CTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAAT
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       AACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTG
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACT
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       CTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCT
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       ATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GCAATTTTGGATGACCTTCTGCCTCTTACCATATTTGACTTCATCCAGTTGTTATTAATT
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GTGATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAACAGTG
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       CCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAACTC
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       AAACAACTGGAATCTGAAGGCAGGAGTCCAATTTTCACTCATCTTGTTACAAGCTTAAAA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GGACTATGGACACTTCGTGCCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GCTCTGAATTTACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCCAA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       ATGAGAATAGAAATGATTTTTGTCATCTTCTTCATTGCTGTTACCTTCATTTCCATTTTA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       ACAACAGGAGAAGGAGAAGGAAGAGTTGGTATTATCCTGACTTTAGCCATGAATATCATG
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       AGTACATTGCAGTGGGCTGTAAACTCCAGCATAGATGTGGATAGCTTGATGCGATCTGTG
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       AGCCGAGTCTTTAAGTTCATTGACATGCCAACAGAAGGTAAACCTACCAAGTCAACCAAA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       CCATACAAGAATGGCCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAAGAAA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTG
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       CTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       CAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTT
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       AGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGAT
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GAGGTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTG
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GATGGGGGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATCTGTT
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       CTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGTAACA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       TACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAATTCTCTGT
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GAACACAGGATAGAAGCAATGCTGGAATGCCAACAATTTTTGGTCATAGAAGAGAACAAA
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       GTGCGGCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGGAGCCTCTTCCGGCAAGCC
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       ATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGCAAGTGCAAGTCT
                                                                              

HsCD00287547      ------------------------------------------------------------
NM_000492.3       AAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGAAGAGGTGCAAGATACAAGGCTT
                                                                              

HsCD00287547      ---
NM_000492.3       TAG
                     

Pathways

Reactome : ABC-family proteins mediated transport
Reactome : Transmembrane transport of small molecules

Protein

Domain : NBD1
SMART domain : AAA : ATPases associated with a variety of cellular activities
Structural Annotation Wiki : TOPSAN
UniProt : P13569
HPRD : 03883

Clone

Cloning Information : 474298
HIP Master Clone ID : 395804
Original Clone ID : 2935c97BCt5b1

Experimental

TargetTrack - Experimental data : 2935c

Organism


TAX_ID : 9606
Species Specific ID: 1080

Genome

Chromosome : 7
Map Location : 7q31.2
Ensembl : ENSG00000001626

Reagents

Labome : CFTR-antibody