DNASU Plasmid Repository • 480.965.5697 | Email

HAVCR2 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HAVCR2
Gene Name:  hepatitis A virus cellular receptor 2
Sequence             
Original Clone ID: 38728
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 24478428
Title: The role of phosphatidylserine receptors in enveloped virus infection
Authors: The ORFeome Collaboration
HsCD00288629

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 906nts         Open reading frame : 1 to 906
Reference Sequence Alignment

ATGTTTTCACATCTTCCCTTTGACTGTGTCCTGCTGCTGCTGCTGCTACTACTTACAAGG
TCCTCAGAAGTGGAATACAGAGCGGAGGTCGGTCAGAATGCCTATCTGCCCTGCTTCTAC
ACCCCAGCCGCCCCAGGGAACCTCGTGCCCGTCTGCTGGGGCAAAGGAGCCTGTCCTGTG
TTTGAATGTGGCAACGTGGTGCTCAGGACTGATGAAAGGGATGTGAATTATTGGACATCC
AGATACTGGCTAAATGGGGATTTCCGCAAAGGAGATGTGTCCCTGACCATAGAGAATGTG
ACTCTAGCAGACAGTGGGATCTACTGCTGCCGGATCCAAATCCCAGGCATAATGAATGAT
GAAAAATTTAACCTGAAGTTGGTCATCAAACCAGCCAAGGTCACCCCTGCACCGACTCTG
CAGAGAGACTTCACTGCAGCCTTTCCAAGGATGCTTACCACCAGGGGACATGGCCCAGCA
GAGACACAGACACTGGGGAGCCTCCCTGATATAAATCTAACACAAATATCCACATTGGCC
AATGAGTTACGGGACTCTAGATTGGCCAATGACTTACGGGACTCTGGAGCAACCATCAGA
ATAGGCATCTACATCGGAGCAGGGATCTGTGCTGGGCTGGCTCTGGCTCTTATCTTCGGC
GCTTTAATTTTCAAATGGTATTCTCATAGCAAAGAGAAGATACAGAATTTAAGCCTCATC
TCTTTGGCCAACCTCCCTCCCTCAGGATTGGCAAATGCAGTAGCAGAGGGAATTCGCTCA
GAAGAAAACATCTATACCATTGAAGAGAACGTATATGAAGTGGAGGAGCCCAATGAGTAT
TATTGCTATGTCAGCAGCAGGCAGCAACCCTCACAACCTTTGGGTTGTCGCTTTGCAATG
CCATAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1050
Start on reference sequence 145
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HAVCR2
Symbol Nomenclature : HAVCR2
SYNONYM : HAVcr-2; KIM-3; TIM3; TIMD-3; TIMD3; Tim-3
Designation : T cell immunoglobulin mucin 3|T cell immunoglobulin mucin-3|T-cell immunoglobulin and mucin domain-containing protein 3|T-cell immunoglobulin mucin family member 3|T-cell immunoglobulin mucin receptor 3|T-cell membrane protein 3|kidney injury molecule-3
Full Nomenclature : hepatitis A virus cellular receptor 2
GENEID : 84868
HGNC : 18437
MIM : 606652
Vega : OTTHUMG00000130249
Target GenBank: BC063431.1

 

Reference Sequence Alignment

  

HsCD00288629      ATGTTTTCACATCTTCCCTTTGACTGTGTCCTGCTGCTGCTGCTGCTACTACTTACAAGG
NM_032782.4       ATGTTTTCACATCTTCCCTTTGACTGTGTCCTGCTGCTGCTGCTGCTACTACTTACAAGG
                  ************************************************************

HsCD00288629      TCCTCAGAAGTGGAATACAGAGCGGAGGTCGGTCAGAATGCCTATCTGCCCTGCTTCTAC
NM_032782.4       TCCTCAGAAGTGGAATACAGAGCGGAGGTCGGTCAGAATGCCTATCTGCCCTGCTTCTAC
                  ************************************************************

HsCD00288629      ACCCCAGCCGCCCCAGGGAACCTCGTGCCCGTCTGCTGGGGCAAAGGAGCCTGTCCTGTG
NM_032782.4       ACCCCAGCCGCCCCAGGGAACCTCGTGCCCGTCTGCTGGGGCAAAGGAGCCTGTCCTGTG
                  ************************************************************

HsCD00288629      TTTGAATGTGGCAACGTGGTGCTCAGGACTGATGAAAGGGATGTGAATTATTGGACATCC
NM_032782.4       TTTGAATGTGGCAACGTGGTGCTCAGGACTGATGAAAGGGATGTGAATTATTGGACATCC
                  ************************************************************

HsCD00288629      AGATACTGGCTAAATGGGGATTTCCGCAAAGGAGATGTGTCCCTGACCATAGAGAATGTG
NM_032782.4       AGATACTGGCTAAATGGGGATTTCCGCAAAGGAGATGTGTCCCTGACCATAGAGAATGTG
                  ************************************************************

HsCD00288629      ACTCTAGCAGACAGTGGGATCTACTGCTGCCGGATCCAAATCCCAGGCATAATGAATGAT
NM_032782.4       ACTCTAGCAGACAGTGGGATCTACTGCTGCCGGATCCAAATCCCAGGCATAATGAATGAT
                  ************************************************************

HsCD00288629      GAAAAATTTAACCTGAAGTTGGTCATCAAACCAGCCAAGGTCACCCCTGCACCGACTCTG
NM_032782.4       GAAAAATTTAACCTGAAGTTGGTCATCAAACCAGCCAAGGTCACCCCTGCACCGACTCGG
                  ********************************************************** *

HsCD00288629      CAGAGAGACTTCACTGCAGCCTTTCCAAGGATGCTTACCACCAGGGGACATGGCCCAGCA
NM_032782.4       CAGAGAGACTTCACTGCAGCCTTTCCAAGGATGCTTACCACCAGGGGACATGGCCCAGCA
                  ************************************************************

HsCD00288629      GAGACACAGACACTGGGGAGCCTCCCTGATATAAATCTAACACAAATATCCACATTGGCC
NM_032782.4       GAGACACAGACACTGGGGAGCCTCCCTGATATAAATCTAACACAAATATCCACATTGGCC
                  ************************************************************

HsCD00288629      AATGAGTTACGGGACTCTAGATTGGCCAATGACTTACGGGACTCTGGAGCAACCATCAGA
NM_032782.4       AATGAGTTACGGGACTCTAGATTGGCCAATGACTTACGGGACTCTGGAGCAACCATCAGA
                  ************************************************************

HsCD00288629      ATAGGCATCTACATCGGAGCAGGGATCTGTGCTGGGCTGGCTCTGGCTCTTATCTTCGGC
NM_032782.4       ATAGGCATCTACATCGGAGCAGGGATCTGTGCTGGGCTGGCTCTGGCTCTTATCTTCGGC
                  ************************************************************

HsCD00288629      GCTTTAATTTTCAAATGGTATTCTCATAGCAAAGAGAAGATACAGAATTTAAGCCTCATC
NM_032782.4       GCTTTAATTTTCAAATGGTATTCTCATAGCAAAGAGAAGATACAGAATTTAAGCCTCATC
                  ************************************************************

HsCD00288629      TCTTTGGCCAACCTCCCTCCCTCAGGATTGGCAAATGCAGTAGCAGAGGGAATTCGCTCA
NM_032782.4       TCTTTGGCCAACCTCCCTCCCTCAGGATTGGCAAATGCAGTAGCAGAGGGAATTCGCTCA
                  ************************************************************

HsCD00288629      GAAGAAAACATCTATACCATTGAAGAGAACGTATATGAAGTGGAGGAGCCCAATGAGTAT
NM_032782.4       GAAGAAAACATCTATACCATTGAAGAGAACGTATATGAAGTGGAGGAGCCCAATGAGTAT
                  ************************************************************

HsCD00288629      TATTGCTATGTCAGCAGCAGGCAGCAACCCTCACAACCTTTGGGTTGTCGCTTTGCAATG
NM_032782.4       TATTGCTATGTCAGCAGCAGGCAGCAACCCTCACAACCTTTGGGTTGTCGCTTTGCAATG
                  ************************************************************

HsCD00288629      CCATAC
NM_032782.4       CCATAG
                  ***** 

Protein

SMART domain : IG : Immunoglobulin
UniProt : Q8TDQ0
HPRD : 16227

Clone

Cloning Information : 471866
HIP Master Clone ID : 394784
Original Clone ID : 38728

Organism


TAX_ID : 9606
Species Specific ID: 84868

Genome

Chromosome : 5
Map Location : 5q33.3
Ensembl : ENSG00000135077

Reagents

Labome : Tim-3-antibody