DNASU Plasmid Repository • 480.965.5697 | Email

LGALS13 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  LGALS13
Gene Name:  lectin, galactoside-binding, soluble, 13
Sequence             
Original Clone ID: 43285
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00288976

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 420nts         Open reading frame : 1 to 420
Reference Sequence Alignment

ATGTCTTCTTTACCCGTGCCATACAAACTGCCTGTGTCTTTGTCTGTTGGTTCCTGCGTG
ATAATCAAAGGGACACCAATCCACTCTTTTATCAATGACCCACAGCTGCAGGTGGATTTC
TACACTGACATGGATGAGGATTCAGATATTGCCTTCCGTTTCCGAGTGCACTTTGGCAAT
CATGTGGTCATGAACAGGCGTGAGTTTGGGATATGGATGTTGGAGGAGACAACAGACTAC
GTGCCCTTTGAGGATGGCAAACAATTTGAGCTGTGCATCTACGTACATTACAATGAGTAT
GAGATAAAGGTCAATGGCATACGCATTTACGGCTTTGTCCATCGAATCCCGCCATCATTT
GTGAAGATGGTGCAAGTGTCGAGAGATATCTCCCTGACCTCAGTGTGTGTCTGCAATTGC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 460
Start on reference sequence 41
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : LGALS13
Symbol Nomenclature : LGALS13
SYNONYM : GAL13; PLAC8; PP13
Designation : beta-galactoside-binding lectin|gal-13|galactoside-binding soluble lectin 13|galectin 13|galectin-13|placental protein 13|placental tissue protein 13
Full Nomenclature : lectin, galactoside-binding, soluble, 13
GENEID : 29124
HGNC : 15449
MIM : 608717
Vega : OTTHUMG00000183073
Target GenBank: BC069312.1

 

Reference Sequence Alignment

  

HsCD00288976      ATGTCTTCTTTACCCGTGCCATACAAACTGCCTGTGTCTTTGTCTGTTGGTTCCTGCGTG
NM_013268.2       ATGTCTTCTTTACCCGTGCCATACAAACTGCCTGTGTCTTTGTCTGTTGGTTCCTGCGTG
                  ************************************************************

HsCD00288976      ATAATCAAAGGGACACCAATCCACTCTTTTATCAATGACCCACAGCTGCAGGTGGATTTC
NM_013268.2       ATAATCAAAGGGACACCAATCCACTCTTTTATCAATGACCCACAGCTGCAGGTGGATTTC
                  ************************************************************

HsCD00288976      TACACTGACATGGATGAGGATTCAGATATTGCCTTCCGTTTCCGAGTGCACTTTGGCAAT
NM_013268.2       TACACTGACATGGATGAGGATTCAGATATTGCCTTCCGTTTCCGAGTGCACTTTGGCAAT
                  ************************************************************

HsCD00288976      CATGTGGTCATGAACAGGCGTGAGTTTGGGATATGGATGTTGGAGGAGACAACAGACTAC
NM_013268.2       CATGTGGTCATGAACAGGCGTGAGTTTGGGATATGGATGTTGGAGGAGACAACAGACTAC
                  ************************************************************

HsCD00288976      GTGCCCTTTGAGGATGGCAAACAATTTGAGCTGTGCATCTACGTACATTACAATGAGTAT
NM_013268.2       GTGCCCTTTGAGGATGGCAAACAATTTGAGCTGTGCATCTACGTACATTACAATGAGTAT
                  ************************************************************

HsCD00288976      GAGATAAAGGTCAATGGCATACGCATTTACGGCTTTGTCCATCGAATCCCGCCATCATTT
NM_013268.2       GAGATAAAGGTCAATGGCATACGCATTTACGGCTTTGTCCATCGAATCCCGCCATCATTT
                  ************************************************************

HsCD00288976      GTGAAGATGGTGCAAGTGTCGAGAGATATCTCCCTGACCTCAGTGTGTGTCTGCAATTGC
NM_013268.2       GTGAAGATGGTGCAAGTGTCGAGAGATATCTCCCTGACCTCAGTGTGTGTCTGCAATTGA
                  ***********************************************************.

Pathways

WikiPathway : Integrated Breast Cancer Pathway

Protein

SMART domain : GLECT : Galectin
SMART domain : Gal-bind_lectin : Galactoside-binding lectin
UniProt : C5HZ15
UniProt : Q9UHV8
HPRD : 16375

Clone

Cloning Information : 472213
HIP Master Clone ID : 395131
Original Clone ID : 43285

Organism


TAX_ID : 9606
Species Specific ID: 29124

Genome

Chromosome : 19
Map Location : 19q13.1
Ensembl : ENSG00000105198

Reagents

Labome : LGALS13-antibody