DNASU Plasmid Repository • 480.965.5697 | Email

AQP10 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AQP10
Gene Name:  aquaporin 10
Sequence             
Original Clone ID: 43636
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: The ORFeome Collaboration
HsCD00289019

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 906nts         Open reading frame : 1 to 906
Reference Sequence Alignment

ATGGTCTTCACTCAGGCCCCGGCTGAAATCATGGGCCACCTCCGGATACGCAGCCTCCTG
GCCCGGCAGTGCCTGGCAGAGTTTCTGGGTGTGTTTGTACTCATGCTCCTCACCCAAGGA
GCTGTGGCCCAGGCTGTCACCAGTGGAGAAACCAAAGGCAACTTCTTCACCATGTTTCTG
GCTGGCTCTCTGGCCGTTACGATAGCCATCTACGTGGGTGGTAACGTCTCAGGGGCCCAC
CTGAATCCAGCCTTCTCCCTGGCCATGTGCATCGTTGGACGCCTCCCCTGGGTCAAGCTC
CCCATTTACATCTTGGTGCAGTTGCTGTCTGCTTTCTGTGCTTCGGGAGCCACCTATGTT
CTCTACTATGATGCCCTACAGAACTATACAGGTGGGAACCTGACAGTGACTGGCCCCAAG
GAGACAGCCTCCATTTTTGCCACCTATCCTGCCCCCTATCTGTCCCTGAACAATGGCTTC
CTGGATCAGGTTCTGGGCACTGGGATGCTGATTGTGGGGCTCTTGGCCATCCTGGACAGA
CGGAACAAGGGAGTCCCTGCGGGTCTGGAGCCTGTGGTGGTGGGGATGCTGATCCTGGCC
CTCGGGTTATCCATGGGTGCCAACTGCGGGATTCCACTCAACCCTGCCCGGGACCTGGGC
CCACGTCTCTTCACCTACGTGGCTGGCTGGGGTCCTGAAGTCTTCAGTGCTGGTAATGGC
TGGTGGTGGGTGCCTGTGGTGGCCCCTCTGGTGGGGGCCACCGTTGGCACAGCCACTTAC
CAGCTGTTGGTGGCTCTGCACCACCCTGAGGGCCCAGAGCCAGCTCAGGATCTGGTGTCT
GCTCAACACAAAGCCTCAGAGTTGGAAACTCCCGCCTCAGCTCAGATGCTGGAGTGTAAG
CTATGC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 946
Start on reference sequence 41
Mutations:
None
Discrepancy:
c367t,H123Y; c501t; t873c
                                

5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : AQP10
Symbol Nomenclature : AQP10
SYNONYM : AQPA_HUMAN
Designation : AQP-10|aquaglyceroporin-10|aquaporin-10|small intestine aquaporin
Full Nomenclature : aquaporin 10
GENEID : 89872
HGNC : 16029
MIM : 606578
Vega : OTTHUMG00000035980
Target GenBank: BC069607.1

 

Reference Sequence Alignment

  

HsCD00289019      ATGGTCTTCACTCAGGCCCCGGCTGAAATCATGGGCCACCTCCGGATACGCAGCCTCCTG
NM_080429.2       ATGGTCTTCACTCAGGCCCCGGCTGAAATCATGGGCCACCTCCGGATACGCAGCCTCCTG
                  ************************************************************

HsCD00289019      GCCCGGCAGTGCCTGGCAGAGTTTCTGGGTGTGTTTGTACTCATGCTCCTCACCCAAGGA
NM_080429.2       GCCCGGCAGTGCCTGGCAGAGTTTCTGGGTGTGTTTGTACTCATGCTCCTCACCCAAGGA
                  ************************************************************

HsCD00289019      GCTGTGGCCCAGGCTGTCACCAGTGGAGAAACCAAAGGCAACTTCTTCACCATGTTTCTG
NM_080429.2       GCTGTGGCCCAGGCTGTCACCAGTGGAGAAACCAAAGGCAACTTCTTCACCATGTTTCTG
                  ************************************************************

HsCD00289019      GCTGGCTCTCTGGCCGTTACGATAGCCATCTACGTGGGTGGTAACGTCTCAGGGGCCCAC
NM_080429.2       GCTGGCTCTCTGGCCGTTACGATAGCCATCTACGTGGGTGGTAACGTCTCAGGGGCCCAC
                  ************************************************************

HsCD00289019      CTGAATCCAGCCTTCTCCCTGGCCATGTGCATCGTTGGACGCCTCCCCTGGGTCAAGCTC
NM_080429.2       CTGAATCCAGCCTTCTCCCTGGCCATGTGCATCGTTGGACGCCTCCCCTGGGTCAAGCTC
                  ************************************************************

HsCD00289019      CCCATTTACATCTTGGTGCAGTTGCTGTCTGCTTTCTGTGCTTCGGGAGCCACCTATGTT
NM_080429.2       CCCATTTACATCTTGGTGCAGTTGCTGTCTGCTTTCTGTGCTTCGGGAGCCACCTATGTT
                  ************************************************************

HsCD00289019      CTCTACTATGATGCCCTACAGAACTATACAGGTGGGAACCTGACAGTGACTGGCCCCAAG
NM_080429.2       CTCTACCATGATGCCCTACAGAACTATACAGGTGGGAACCTGACAGTGACTGGCCCCAAG
                  ****** *****************************************************

HsCD00289019      GAGACAGCCTCCATTTTTGCCACCTATCCTGCCCCCTATCTGTCCCTGAACAATGGCTTC
NM_080429.2       GAGACAGCCTCCATTTTTGCCACCTATCCTGCCCCCTATCTGTCCCTGAACAATGGCTTC
                  ************************************************************

HsCD00289019      CTGGATCAGGTTCTGGGCACTGGGATGCTGATTGTGGGGCTCTTGGCCATCCTGGACAGA
NM_080429.2       CTGGATCAGGTTCTGGGCACTGGGATGCTGATTGTGGGGCTCTTGGCCATCCTGGACAGA
                  ************************************************************

HsCD00289019      CGGAACAAGGGAGTCCCTGCGGGTCTGGAGCCTGTGGTGGTGGGGATGCTGATCCTGGCC
NM_080429.2       CGGAACAAGGGAGTCCCTGCGGGTCTGGAGCCTGTGGTGGTGGGGATGCTGATCCTGGCC
                  ************************************************************

HsCD00289019      CTCGGGTTATCCATGGGTGCCAACTGCGGGATTCCACTCAACCCTGCCCGGGACCTGGGC
NM_080429.2       CTCGGGTTATCCATGGGTGCCAACTGCGGGATTCCACTCAACCCTGCCCGGGACCTGGGC
                  ************************************************************

HsCD00289019      CCACGTCTCTTCACCTACGTGGCTGGCTGGGGTCCTGAAGTCTTCAGTGCTGGTAATGGC
NM_080429.2       CCACGTCTCTTCACCTACGTGGCTGGCTGGGGTCCTGAAGTCTTCAGTGCTGGTAATGGC
                  ************************************************************

HsCD00289019      TGGTGGTGGGTGCCTGTGGTGGCCCCTCTGGTGGGGGCCACCGTTGGCACAGCCACTTAC
NM_080429.2       TGGTGGTGGGTGCCTGTGGTGGCCCCTCTGGTGGGGGCCACCGTTGGCACAGCCACTTAC
                  ************************************************************

HsCD00289019      CAGCTGTTGGTGGCTCTGCACCACCCTGAGGGCCCAGAGCCAGCTCAGGATCTGGTGTCT
NM_080429.2       CAGCTGTTGGTGGCTCTGCACCACCCTGAGGGCCCAGAGCCAGCTCAGGATCTGGTGTCT
                  ************************************************************

HsCD00289019      GCTCAACACAAAGCCTCAGAGTTGGAAACTCCCGCCTCAGCTCAGATGCTGGAGTGTAAG
NM_080429.2       GCTCAACACAAAGCCTCAGAGTTGGAAACTCCTGCCTCAGCTCAGATGCTGGAGTGTAAG
                  ******************************** ***************************

HsCD00289019      CTATGC
NM_080429.2       CTATGA
                  *****.

Pathways

Reactome : Aquaporin-mediated transport
Reactome : Passive transport by Aquaporins
Reactome : Transmembrane transport of small molecules

Protein

UniProt : Q96PS8
HPRD : 07361

Clone

Cloning Information : 472256
HIP Master Clone ID : 395174
Original Clone ID : 43636

Organism


TAX_ID : 9606
Species Specific ID: 89872

Genome

Chromosome : 1
Map Location : 1q21.3
Ensembl : ENSG00000143595

Reagents

Labome : AQP10-antibody