DNASU Plasmid Repository • 480.965.5697 | Email

SOCS4 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SOCS4
Gene Name:  suppressor of cytokine signaling 4
Sequence             
Original Clone ID: 36273
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00289111

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1323nts         Open reading frame : 1 to 1323
Reference Sequence Alignment

ATGGCAGAAAATAATGAAAATATTAGTAAAAATGTAGATGTAAGGCCCAAAACTAGTCGG
AGCAGAAGTGCCGACAGAAAAGACGGTTATGTGTGGAGTGGAAAGAAGTTATCTTGGTCA
AAAAAGAGTGAGAGTTATTCAGATGCTGAGACAGTGAATGGTATAGAGAAAACCGAAGTG
TCTTTAAGGAACCAAGAAAGGAAGCACAGCTGTTCATCCATTGAGTTGGACTTAGATCAT
TCCTGTGGGCATCGATTTTTAGGCCGATCTCTTAAACAGAAACTGCAAGATGCCGTGGGG
CAGTGTTTTCCAATAAAGAATTGTAGTAGTCGGCACTCTTCAGGGCTTCCGTCTAAAAGG
AAAATTCATATCAGTGAACTCATGTTAGATAAGTGTCCTTTCCCACCTCGATCAGATTTA
GCCTTTAGGTGGCATTTTATTAAACGACACACTGCTCCTATAAATTCCAAATCAGATGAA
TGGGTAAGCACAGACTTGTCTCAGACTGAATTGAGGGATGGTCAGCTAAAACGAAGAAAT
ATGGAAGAAAATATAAACTGTTTCTCACATACCAATGTTCAGCCCTGTGTCATAACCACC
GACAATGCTTTGTGTAGAGAAGGTCCTATGACTGGCTCTGTGATGAACCTGGTTTCAAAT
AACAGTATAGAAGATAGTGATATGGATTCCGATGATGAAATTCTAACACTTTGCACAAGT
TCCAGAAAAAGAAACAAACCCAAATGGGATTTGGATGATGAAATCCTGCAGTTGGAAACA
CCTCCTAAATACCACACGCAGATTGATTATGTCCACTGTCTTGTACCAGACCTCCTTCAG
ATCAATAACAACCCATGTTACTGGGGAGTGATGGATAAATACGCAGCCGAAGCACTACTG
GAAGGAAAACCAGAGGGTACCTTTTTACTTCGAGACTCAGCACAGGAAGACTATTTATTC
TCTGTTAGTTTTAGACGCTATAGTCGTTCTCTTCATGCTAGAATTGAACAGTGGAATCAC
AACTTTAGCTTTGATGCACATGACCCCTGTGTCTTCCATTCTCCTGACATTACTGGGCTC
CTAGAACATTATAAGGACCCAAGCGCCTGTATGTTCTTTGAACCACTTCTATCCACTCCC
TTAATTCGGACTTTCCCTTTTTCCCTGCAGCATATATGCAGAACAGTTATTTGTAACTGT
ACAACTTATGATGGCATCGATGCCCTTCCAATTCCTTCTTCTATGAAATTATATCTGAAG
GAATATCATTATAAATCAAAAGTTAGAGTACTCAGGATTGATGCACCAGAACAGCAATGC
TAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1766
Start on reference sequence 444
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGTTGGC

3' Linker Sequence:
5p (goi-stop)CCAACTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SOCS4
Symbol Nomenclature : SOCS4
SYNONYM : SOCS7
Designation : SH2 domain containing SOCS box protein|SOCS-4|SOCS-7|suppressor of cytokine signaling 7
Full Nomenclature : suppressor of cytokine signaling 4
GENEID : 122809
HGNC : 19392
Vega : OTTHUMG00000140311
Target GenBank: BC060790.1

 

Reference Sequence Alignment

  

HsCD00289111      ATGGCAGAAAATAATGAAAATATTAGTAAAAATGTAGATGTAAGGCCCAAAACTAGTCGG
NM_080867.2       ATGGCAGAAAATAATGAAAATATTAGTAAAAATGTAGATGTAAGGCCCAAAACTAGTCGG
NM_199421.1       ATGGCAGAAAATAATGAAAATATTAGTAAAAATGTAGATGTAAGGCCCAAAACTAGTCGG
                  ************************************************************

HsCD00289111      AGCAGAAGTGCCGACAGAAAAGACGGTTATGTGTGGAGTGGAAAGAAGTTATCTTGGTCA
NM_080867.2       AGCAGAAGTGCCGACAGAAAAGACGGTTATGTGTGGAGTGGAAAGAAGTTATCTTGGTCA
NM_199421.1       AGCAGAAGTGCCGACAGAAAAGACGGTTATGTGTGGAGTGGAAAGAAGTTATCTTGGTCA
                  ************************************************************

HsCD00289111      AAAAAGAGTGAGAGTTATTCAGATGCTGAGACAGTGAATGGTATAGAGAAAACCGAAGTG
NM_080867.2       AAAAAGAGTGAGAGTTATTCAGATGCTGAGACAGTGAATGGTATAGAGAAAACCGAAGTG
NM_199421.1       AAAAAGAGTGAGAGTTATTCAGATGCTGAGACAGTGAATGGTATAGAGAAAACCGAAGTG
                  ************************************************************

HsCD00289111      TCTTTAAGGAACCAAGAAAGGAAGCACAGCTGTTCATCCATTGAGTTGGACTTAGATCAT
NM_080867.2       TCTTTAAGGAACCAAGAAAGGAAGCACAGCTGTTCATCCATTGAGTTGGACTTAGATCAT
NM_199421.1       TCTTTAAGGAACCAAGAAAGGAAGCACAGCTGTTCATCCATTGAGTTGGACTTAGATCAT
                  ************************************************************

HsCD00289111      TCCTGTGGGCATCGATTTTTAGGCCGATCTCTTAAACAGAAACTGCAAGATGCCGTGGGG
NM_080867.2       TCCTGTGGGCATCGATTTTTAGGCCGATCTCTTAAACAGAAACTGCAAGATGCCGTGGGG
NM_199421.1       TCCTGTGGGCATCGATTTTTAGGCCGATCTCTTAAACAGAAACTGCAAGATGCCGTGGGG
                  ************************************************************

HsCD00289111      CAGTGTTTTCCAATAAAGAATTGTAGTAGTCGGCACTCTTCAGGGCTTCCGTCTAAAAGG
NM_080867.2       CAGTGTTTTCCAATAAAGAATTGTAGTAGTCGGCACTCTTCAGGGCTTCCGTCTAAAAGG
NM_199421.1       CAGTGTTTTCCAATAAAGAATTGTAGTAGTCGGCACTCTTCAGGGCTTCCGTCTAAAAGG
                  ************************************************************

HsCD00289111      AAAATTCATATCAGTGAACTCATGTTAGATAAGTGTCCTTTCCCACCTCGATCAGATTTA
NM_080867.2       AAAATTCATATCAGTGAACTCATGTTAGATAAGTGTCCTTTCCCACCTCGATCAGATTTA
NM_199421.1       AAAATTCATATCAGTGAACTCATGTTAGATAAGTGTCCTTTCCCACCTCGATCAGATTTA
                  ************************************************************

HsCD00289111      GCCTTTAGGTGGCATTTTATTAAACGACACACTGCTCCTATAAATTCCAAATCAGATGAA
NM_080867.2       GCCTTTAGGTGGCATTTTATTAAACGACACACTGCTCCTATAAATTCCAAATCAGATGAA
NM_199421.1       GCCTTTAGGTGGCATTTTATTAAACGACACACTGCTCCTATAAATTCCAAATCAGATGAA
                  ************************************************************

HsCD00289111      TGGGTAAGCACAGACTTGTCTCAGACTGAATTGAGGGATGGTCAGCTAAAACGAAGAAAT
NM_080867.2       TGGGTAAGCACAGACTTGTCTCAGACTGAATTGAGGGATGGTCAGCTAAAACGAAGAAAT
NM_199421.1       TGGGTAAGCACAGACTTGTCTCAGACTGAATTGAGGGATGGTCAGCTAAAACGAAGAAAT
                  ************************************************************

HsCD00289111      ATGGAAGAAAATATAAACTGTTTCTCACATACCAATGTTCAGCCCTGTGTCATAACCACC
NM_080867.2       ATGGAAGAAAATATAAACTGTTTCTCACATACCAATGTTCAGCCCTGTGTCATAACCACC
NM_199421.1       ATGGAAGAAAATATAAACTGTTTCTCACATACCAATGTTCAGCCCTGTGTCATAACCACC
                  ************************************************************

HsCD00289111      GACAATGCTTTGTGTAGAGAAGGTCCTATGACTGGCTCTGTGATGAACCTGGTTTCAAAT
NM_080867.2       GACAATGCTTTGTGTAGAGAAGGTCCTATGACTGGCTCTGTGATGAACCTGGTTTCAAAT
NM_199421.1       GACAATGCTTTGTGTAGAGAAGGTCCTATGACTGGCTCTGTGATGAACCTGGTTTCAAAT
                  ************************************************************

HsCD00289111      AACAGTATAGAAGATAGTGATATGGATTCCGATGATGAAATTCTAACACTTTGCACAAGT
NM_080867.2       AACAGTATAGAAGATAGTGATATGGATTCCGATGATGAAATTCTAACACTTTGCACAAGT
NM_199421.1       AACAGTATAGAAGATAGTGATATGGATTCCGATGATGAAATTCTAACACTTTGCACAAGT
                  ************************************************************

HsCD00289111      TCCAGAAAAAGAAACAAACCCAAATGGGATTTGGATGATGAAATCCTGCAGTTGGAAACA
NM_080867.2       TCCAGAAAAAGAAACAAACCCAAATGGGATTTGGATGATGAAATCCTGCAGTTGGAAACA
NM_199421.1       TCCAGAAAAAGAAACAAACCCAAATGGGATTTGGATGATGAAATCCTGCAGTTGGAAACA
                  ************************************************************

HsCD00289111      CCTCCTAAATACCACACGCAGATTGATTATGTCCACTGTCTTGTACCAGACCTCCTTCAG
NM_080867.2       CCTCCTAAATACCACACGCAGATTGATTATGTCCACTGTCTTGTACCAGACCTCCTTCAG
NM_199421.1       CCTCCTAAATACCACACGCAGATTGATTATGTCCACTGTCTTGTACCAGACCTCCTTCAG
                  ************************************************************

HsCD00289111      ATCAATAACAACCCATGTTACTGGGGAGTGATGGATAAATACGCAGCCGAAGCACTACTG
NM_080867.2       ATCAATAACAACCCATGTTACTGGGGAGTGATGGATAAATACGCAGCCGAAGCACTACTG
NM_199421.1       ATCAATAACAACCCATGTTACTGGGGAGTGATGGATAAATACGCAGCCGAAGCACTACTG
                  ************************************************************

HsCD00289111      GAAGGAAAACCAGAGGGTACCTTTTTACTTCGAGACTCAGCACAGGAAGACTATTTATTC
NM_080867.2       GAAGGAAAACCAGAGGGTACCTTTTTACTTCGAGACTCAGCACAGGAAGACTATTTATTC
NM_199421.1       GAAGGAAAACCAGAGGGTACCTTTTTACTTCGAGACTCAGCACAGGAAGACTATTTATTC
                  ************************************************************

HsCD00289111      TCTGTTAGTTTTAGACGCTATAGTCGTTCTCTTCATGCTAGAATTGAACAGTGGAATCAC
NM_080867.2       TCTGTTAGTTTTAGACGCTATAGTCGTTCTCTTCATGCTAGAATTGAACAGTGGAATCAC
NM_199421.1       TCTGTTAGTTTTAGACGCTATAGTCGTTCTCTTCATGCTAGAATTGAACAGTGGAATCAC
                  ************************************************************

HsCD00289111      AACTTTAGCTTTGATGCACATGACCCCTGTGTCTTCCATTCTCCTGACATTACTGGGCTC
NM_080867.2       AACTTTAGCTTTGATGCACATGACCCCTGTGTCTTCCATTCTCCTGACATTACTGGGCTC
NM_199421.1       AACTTTAGCTTTGATGCACATGACCCCTGTGTCTTCCATTCTCCTGACATTACTGGGCTC
                  ************************************************************

HsCD00289111      CTAGAACATTATAAGGACCCAAGCGCCTGTATGTTCTTTGAACCACTTCTATCCACTCCC
NM_080867.2       CTAGAACATTATAAGGACCCAAGCGCCTGTATGTTCTTTGAACCACTTCTATCCACTCCC
NM_199421.1       CTAGAACATTATAAGGACCCAAGCGCCTGTATGTTCTTTGAACCACTTCTATCCACTCCC
                  ************************************************************

HsCD00289111      TTAATTCGGACTTTCCCTTTTTCCCTGCAGCATATATGCAGAACAGTTATTTGTAACTGT
NM_080867.2       TTAATTCGGACTTTCCCTTTTTCCCTGCAGCATATATGCAGAACAGTTATTTGTAACTGT
NM_199421.1       TTAATTCGGACTTTCCCTTTTTCCCTGCAGCATATATGCAGAACAGTTATTTGTAACTGT
                  ************************************************************

HsCD00289111      ACAACTTATGATGGCATCGATGCCCTTCCAATTCCTTCTTCTATGAAATTATATCTGAAG
NM_080867.2       ACAACTTATGATGGCATCGATGCCCTTCCAATTCCTTCTTCTATGAAATTATATCTGAAG
NM_199421.1       ACAACTTATGATGGCATCGATGCCCTTCCAATTCCTTCTTCTATGAAATTATATCTGAAG
                  ************************************************************

HsCD00289111      GAATATCATTATAAATCAAAAGTTAGAGTACTCAGGATTGATGCACCAGAACAGCAATGC
NM_080867.2       GAATATCATTATAAATCAAAAGTTAGAGTACTCAGGATTGATGCACCAGAACAGCAATGC
NM_199421.1       GAATATCATTATAAATCAAAAGTTAGAGTACTCAGGATTGATGCACCAGAACAGCAATGC
                  ************************************************************

HsCD00289111      TAC
NM_080867.2       TAG
NM_199421.1       TAG
                  ** 

Pathways

Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Interferon-gamma signaling pathway
WikiPathway : Type II diabetes mellitus

Protein

SMART domain : SOCS_box :
SMART domain : SH2 : Src homology 2 domains
SMART domain : SOCS : suppressors of cytokine signalling
UniProt : Q8WXH5
UniProt : Q5H9R6
HPRD : 18084

Clone

Cloning Information : 472348
HIP Master Clone ID : 395266
Original Clone ID : 36273

Organism


TAX_ID : 9606
Species Specific ID: 122809

Genome

Chromosome : 14
Map Location : 14q22.1
Ensembl : ENSG00000180008

Reagents

Labome : SOCS4-antibody