DNASU Plasmid Repository • 480.965.5697 | Email

GPR110 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GPR110
Gene Name:  G protein-coupled receptor 110
Sequence             
Original Clone ID: FLH481434.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00295179

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2733nts         Open reading frame : 35 to 2733
Reference Sequence Alignment

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAAAGTTGGAGTGCTGTGGCTCAT
TTCTTTCTTCACCTTCACTGACGGCCACGGTGGCTTCCTGGGGAAAAATGATGGCATCAA
AACAAAAAAAGAACTCATTGTGAATAAGAAAAAACATCTAGGCCCAGTCGAAGAATATCA
GCTGCTGCTTCAGGTGACCTATAGAGATTCCAAGGAGAAAAGAGATTTGAGAAATTTTCT
GAAGCTCTTGAAGCCTCCATTATTATGGTCACATGGGCTAATTAGAATTATCAGAGCAAA
GGCTACCACAGACTGCAACAGCCTGAATGGAGTCCTGCAGTGTACCTGTGAAGACAGCTA
CACCTGGTTTCCTCCCTCATGCCTTGATCCCCAGAACTGCTACCTTCACACGGCTGGAGC
ACTCCCAAGCTGTGAATGTCATCTCAACAACCTCAGCCAGAGTGTCAATTTCTGTGAGAG
AACAAAGATTTGGGGCACTTTCAAAATTAATGAAAGGTTTACAAATGACCTTTTGAATTC
ATCTTCTGCTATATACTCCAAATATGCAAATGGAATTGAAATTCAACTTAAAAAAGCATA
TGAAAGAATTCAAGGTTTTGAGTCGGTTCAGGTCACCCAATTTCGAAATGGAAGCATCGT
TGCTGGGTATGAAGTTGTTGGCTCCAGCAGTGCATCTGAACTGCTGTCAGCCATTGAACA
TGTTGCCGAGAAGGCTAAGACAGCCCTTCACAAGCTGTTTCCATTAGAAGACGGCTCTTT
CAGAGTGTTCGGAAAAGCCCAGTGTAATGACATTGTCTTTGGATTTGGGTCCAAGGATGA
TGAATATACCCTGCCCTGCAGCAGTGGCTACAGGGGAAACATCACAGCCAAGTGTGAGTC
CTCTGGGTGGCAGGTCATCAGGGAGACTTGTGTGCTCTCTCTGCTTGAAGAACTGAACAA
GAATTTCAGTATGATTGTAGGCAATGCCACTGAGGCAGCTGTGTCATCCTTCGTGCAAAA
TCTTTCTGTCATCATTCGGCAAAACCCATCAACCACAGTGGGGAATCTGGCTTCGGTGGT
GTCGATTCTGAGCAATATTTCATCTCTGTCACTGGCCAGCCATTTCAGGGTGTCCAATTC
AACAATGGAGGATGTCATCAGTATAGCTGACAATATCCTTAATTCAGCCTCAGTAACCAA
CTGGACAGTCTTACTGCGGGAAGAAAAGTATGCCAGCTCACGGTTACTAGAGACATTAGA
AAACATCAGCACTCTGGTGCCTCCGACAGCTCTTCCTCTGAATTTTTCTCGGAAATTCAT
TGACTGGAAAGGGATTCCAGTGAACAAAAGCCAACTCAAAAGGGGTTACAGCTATCAGAT
TAAAATGTGTCCCCAAAATACATCTATTCCCATCAGAGGCCGTGTGTTAATTGGGTCAGA
CCAATTCCAGAGATCCCTTCCAGAAACTATTATCAGCATGGCCTCGTTGACTCTGGGGAA
CATTCTACCCGTTTCCAAAAATGGAAATGCTCAGGTCAATGGACCTGTGATATCCACGGT
TATTCAAAACTATTCCATAAATGAAGTTTTCCTATTTTTTTCCAAGATAGAGTCAAACCT
GAGCCAGCCTCATTGTGTGTTTTGGGATTTCAGTCATTTGCAGTGGAACGATGCAGGCTG
CCACCTAGTGAATGAAACTCAAGACATCGTGACGTGCCAATGTACTCACTTGACCTCCTT
CTCCATATTGATGTCACCTTTTGTCCCCTCTACAATCTTCCCCGTTGTAAAATGGATCAC
CTATGTGGGACTGGGTATCTCCATTGGAAGTCTCATTTTATGCCTGATCATCGAGGCTTT
GTTTTGGAAGCAGATTAAAAAAAGCCAAACCTCTCACACACGTCGTATTTGCATGGTGAA
CATAGCCCTGTCCCTCTTGATTGCTGATGTCTGGTTTATTGTTGGTGCCACAGTGGACAC
CACGGTGAACCCTTCTGGAGTCTGCACAGCTGCTGTGTTCTTTACACACTTCTTCTACCT
CTCTTTGTTCTTCTGGATGCTCATGCTTGGCATCCTGCTGGCTTACCGGATCATCCTCGT
GTTCCATCACATGGCCCAGCATTTGATGATGGCTGTTGGATTTTGCCTGGGTTATGGGTG
CCCTCTCATTATATCTGTCATTACCATTGCTGTCACGCAACCTAGCAATACCTACAAAAG
GAAAGATGTGTGTTGGCTTAACTGGTCCAATGGAAGCAAACCACTCCTGGCTTTTGTTGT
CCCTGCACTGGCTATTGTGGCTGTGAACTTCGTTGTGGTGCTGCTAGTTCTCACAAAGCT
CTGGAGGCCGACTGTTGGGGAAAGACTGAGTCGGGATGACAAGGCCACCATCATCCGCGT
GGGGAAGAGCCTCCTCATTCTGACCCCTCTGCTAGGGCTCACCTGGGGCTTTGGAATAGG
AACAATAGTGGACAGCCAGAATCTGGCTTGGCATGTTATTTTTGCTTTACTCAATGCATT
CCAGGGATTTTTTATCTTATGCTTTGGAATACTCTTGGACAGTAAGCTGCGACAACTTCT
GTTCAACAAGTTGTCTGCCTTAAGTTCTTGGAAGCAAACAGAAAAGCAAAACTCATCAGA
TTTATCTGCCAAACCCAAATTCTCAAAGCCTTTCAACCCACTGCAAAACAAAGGCCATTA
TGCATTTTCTCATACTGGAGATTCCTCCGACAACATCATGCTAACTCAGTTTGTCTCAAA
TGAATAGGGCCTCATGGGCCCAGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2932
Start on reference sequence 200
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TAAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GPR110
Symbol Nomenclature : GPR110
SYNONYM : KPG_012; PGR19; hGPCR36
Designation : G protein-coupled receptor PGR19|G-protein coupled receptor 110|G-protein coupled receptor KPG_012|G-protein coupled receptor PGR19|probable G-protein coupled receptor 110|seven transmembrane helix receptor
Full Nomenclature : G protein-coupled receptor 110
GENEID : 266977
Locus Tag : RP11-39C2.1
GI : 182888212
GenBank Accession : BC160016
HGNC : 18990
Vega : OTTHUMG00000014795
Target GenBank: NM_153840.2

 

Reference Sequence Alignment

  

HsCD00295179      GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAAAGTTGGAGTGCTGTGGCTCAT
NM_153840.2       ----------------------------------ATGAAAGTTGGAGTGCTGTGGCTCAT
                                                    **************************

HsCD00295179      TTCTTTCTTCACCTTCACTGACGGCCACGGTGGCTTCCTGGGGAAAAATGATGGCATCAA
NM_153840.2       TTCTTTCTTCACCTTCACTGACGGCCACGGTGGCTTCCTGGGGAAAAATGATGGCATCAA
                  ************************************************************

HsCD00295179      AACAAAAAAAGAACTCATTGTGAATAAGAAAAAACATCTAGGCCCAGTCGAAGAATATCA
NM_153840.2       AACAAAAAAAGAACTCATTGTGAATAAGAAAAAACATCTAGGCCCAGTCGAAGAATATCA
                  ************************************************************

HsCD00295179      GCTGCTGCTTCAGGTGACCTATAGAGATTCCAAGGAGAAAAGAGATTTGAGAAATTTTCT
NM_153840.2       GCTGCTGCTTCAGGTGACCTATAGAGATTCCAAGGAGAAAAGAGATTTGAGAAATTTTCT
                  ************************************************************

HsCD00295179      GAAGCTCTTGAAGCCTCCATTATTATGGTCACATGGGCTAATTAGAATTATCAGAGCAAA
NM_153840.2       GAAGCTCTTGAAGCCTCCATTATTATGGTCACATGGGCTAATTAGAATTATCAGAGCAAA
                  ************************************************************

HsCD00295179      GGCTACCACAGACTGCAACAGCCTGAATGGAGTCCTGCAGTGTACCTGTGAAGACAGCTA
NM_153840.2       GGCTACCACAGACTGCAACAGCCTGAATGGAGTCCTGCAGTGTACCTGTGAAGACAGCTA
                  ************************************************************

HsCD00295179      CACCTGGTTTCCTCCCTCATGCCTTGATCCCCAGAACTGCTACCTTCACACGGCTGGAGC
NM_153840.2       CACCTGGTTTCCTCCCTCATGCCTTGATCCCCAGAACTGCTACCTTCACACGGCTGGAGC
                  ************************************************************

HsCD00295179      ACTCCCAAGCTGTGAATGTCATCTCAACAACCTCAGCCAGAGTGTCAATTTCTGTGAGAG
NM_153840.2       ACTCCCAAGCTGTGAATGTCATCTCAACAACCTCAGCCAGAGTGTCAATTTCTGTGAGAG
                  ************************************************************

HsCD00295179      AACAAAGATTTGGGGCACTTTCAAAATTAATGAAAGGTTTACAAATGACCTTTTGAATTC
NM_153840.2       AACAAAGATTTGGGGCACTTTCAAAATTAATGAAAGGTTTACAAATGACCTTTTGAATTC
                  ************************************************************

HsCD00295179      ATCTTCTGCTATATACTCCAAATATGCAAATGGAATTGAAATTCAACTTAAAAAAGCATA
NM_153840.2       ATCTTCTGCTATATACTCCAAATATGCAAATGGAATTGAAATTCAACTTAAAAAAGCATA
                  ************************************************************

HsCD00295179      TGAAAGAATTCAAGGTTTTGAGTCGGTTCAGGTCACCCAATTTCGAAATGGAAGCATCGT
NM_153840.2       TGAAAGAATTCAAGGTTTTGAGTCGGTTCAGGTCACCCAATTTCGAAATGGAAGCATCGT
                  ************************************************************

HsCD00295179      TGCTGGGTATGAAGTTGTTGGCTCCAGCAGTGCATCTGAACTGCTGTCAGCCATTGAACA
NM_153840.2       TGCTGGGTATGAAGTTGTTGGCTCCAGCAGTGCATCTGAACTGCTGTCAGCCATTGAACA
                  ************************************************************

HsCD00295179      TGTTGCCGAGAAGGCTAAGACAGCCCTTCACAAGCTGTTTCCATTAGAAGACGGCTCTTT
NM_153840.2       TGTTGCCGAGAAGGCTAAGACAGCCCTTCACAAGCTGTTTCCATTAGAAGACGGCTCTTT
                  ************************************************************

HsCD00295179      CAGAGTGTTCGGAAAAGCCCAGTGTAATGACATTGTCTTTGGATTTGGGTCCAAGGATGA
NM_153840.2       CAGAGTGTTCGGAAAAGCCCAGTGTAATGACATTGTCTTTGGATTTGGGTCCAAGGATGA
                  ************************************************************

HsCD00295179      TGAATATACCCTGCCCTGCAGCAGTGGCTACAGGGGAAACATCACAGCCAAGTGTGAGTC
NM_153840.2       TGAATATACCCTGCCCTGCAGCAGTGGCTACAGGGGAAACATCACAGCCAAGTGTGAGTC
                  ************************************************************

HsCD00295179      CTCTGGGTGGCAGGTCATCAGGGAGACTTGTGTGCTCTCTCTGCTTGAAGAACTGAACAA
NM_153840.2       CTCTGGGTGGCAGGTCATCAGGGAGACTTGTGTGCTCTCTCTGCTTGAAGAACTGAACAA
                  ************************************************************

HsCD00295179      GAATTTCAGTATGATTGTAGGCAATGCCACTGAGGCAGCTGTGTCATCCTTCGTGCAAAA
NM_153840.2       GAATTTCAGTATGATTGTAGGCAATGCCACTGAGGCAGCTGTGTCATCCTTCGTGCAAAA
                  ************************************************************

HsCD00295179      TCTTTCTGTCATCATTCGGCAAAACCCATCAACCACAGTGGGGAATCTGGCTTCGGTGGT
NM_153840.2       TCTTTCTGTCATCATTCGGCAAAACCCATCAACCACAGTGGGGAATCTGGCTTCGGTGGT
                  ************************************************************

HsCD00295179      GTCGATTCTGAGCAATATTTCATCTCTGTCACTGGCCAGCCATTTCAGGGTGTCCAATTC
NM_153840.2       GTCGATTCTGAGCAATATTTCATCTCTGTCACTGGCCAGCCATTTCAGGGTGTCCAATTC
                  ************************************************************

HsCD00295179      AACAATGGAGGATGTCATCAGTATAGCTGACAATATCCTTAATTCAGCCTCAGTAACCAA
NM_153840.2       AACAATGGAGGATGTCATCAGTATAGCTGACAATATCCTTAATTCAGCCTCAGTAACCAA
                  ************************************************************

HsCD00295179      CTGGACAGTCTTACTGCGGGAAGAAAAGTATGCCAGCTCACGGTTACTAGAGACATTAGA
NM_153840.2       CTGGACAGTCTTACTGCGGGAAGAAAAGTATGCCAGCTCACGGTTACTAGAGACATTAGA
                  ************************************************************

HsCD00295179      AAACATCAGCACTCTGGTGCCTCCGACAGCTCTTCCTCTGAATTTTTCTCGGAAATTCAT
NM_153840.2       AAACATCAGCACTCTGGTGCCTCCGACAGCTCTTCCTCTGAATTTTTCTCGGAAATTCAT
                  ************************************************************

HsCD00295179      TGACTGGAAAGGGATTCCAGTGAACAAAAGCCAACTCAAAAGGGGTTACAGCTATCAGAT
NM_153840.2       TGACTGGAAAGGGATTCCAGTGAACAAAAGCCAACTCAAAAGGGGTTACAGCTATCAGAT
                  ************************************************************

HsCD00295179      TAAAATGTGTCCCCAAAATACATCTATTCCCATCAGAGGCCGTGTGTTAATTGGGTCAGA
NM_153840.2       TAAAATGTGTCCCCAAAATACATCTATTCCCATCAGAGGCCGTGTGTTAATTGGGTCAGA
                  ************************************************************

HsCD00295179      CCAATTCCAGAGATCCCTTCCAGAAACTATTATCAGCATGGCCTCGTTGACTCTGGGGAA
NM_153840.2       CCAATTCCAGAGATCCCTTCCAGAAACTATTATCAGCATGGCCTCGTTGACTCTGGGGAA
                  ************************************************************

HsCD00295179      CATTCTACCCGTTTCCAAAAATGGAAATGCTCAGGTCAATGGACCTGTGATATCCACGGT
NM_153840.2       CATTCTACCCGTTTCCAAAAATGGAAATGCTCAGGTCAATGGACCTGTGATATCCACGGT
                  ************************************************************

HsCD00295179      TATTCAAAACTATTCCATAAATGAAGTTTTCCTATTTTTTTCCAAGATAGAGTCAAACCT
NM_153840.2       TATTCAAAACTATTCCATAAATGAAGTTTTCCTATTTTTTTCCAAGATAGAGTCAAACCT
                  ************************************************************

HsCD00295179      GAGCCAGCCTCATTGTGTGTTTTGGGATTTCAGTCATTTGCAGTGGAACGATGCAGGCTG
NM_153840.2       GAGCCAGCCTCATTGTGTGTTTTGGGATTTCAGTCATTTGCAGTGGAACGATGCAGGCTG
                  ************************************************************

HsCD00295179      CCACCTAGTGAATGAAACTCAAGACATCGTGACGTGCCAATGTACTCACTTGACCTCCTT
NM_153840.2       CCACCTAGTGAATGAAACTCAAGACATCGTGACGTGCCAATGTACTCACTTGACCTCCTT
                  ************************************************************

HsCD00295179      CTCCATATTGATGTCACCTTTTGTCCCCTCTACAATCTTCCCCGTTGTAAAATGGATCAC
NM_153840.2       CTCCATATTGATGTCACCTTTTGTCCCCTCTACAATCTTCCCCGTTGTAAAATGGATCAC
                  ************************************************************

HsCD00295179      CTATGTGGGACTGGGTATCTCCATTGGAAGTCTCATTTTATGCCTGATCATCGAGGCTTT
NM_153840.2       CTATGTGGGACTGGGTATCTCCATTGGAAGTCTCATTTTATGCCTGATCATCGAGGCTTT
                  ************************************************************

HsCD00295179      GTTTTGGAAGCAGATTAAAAAAAGCCAAACCTCTCACACACGTCGTATTTGCATGGTGAA
NM_153840.2       GTTTTGGAAGCAGATTAAAAAAAGCCAAACCTCTCACACACGTCGTATTTGCATGGTGAA
                  ************************************************************

HsCD00295179      CATAGCCCTGTCCCTCTTGATTGCTGATGTCTGGTTTATTGTTGGTGCCACAGTGGACAC
NM_153840.2       CATAGCCCTGTCCCTCTTGATTGCTGATGTCTGGTTTATTGTTGGTGCCACAGTGGACAC
                  ************************************************************

HsCD00295179      CACGGTGAACCCTTCTGGAGTCTGCACAGCTGCTGTGTTCTTTACACACTTCTTCTACCT
NM_153840.2       CACGGTGAACCCTTCTGGAGTCTGCACAGCTGCTGTGTTCTTTACACACTTCTTCTACCT
                  ************************************************************

HsCD00295179      CTCTTTGTTCTTCTGGATGCTCATGCTTGGCATCCTGCTGGCTTACCGGATCATCCTCGT
NM_153840.2       CTCTTTGTTCTTCTGGATGCTCATGCTTGGCATCCTGCTGGCTTACCGGATCATCCTCGT
                  ************************************************************

HsCD00295179      GTTCCATCACATGGCCCAGCATTTGATGATGGCTGTTGGATTTTGCCTGGGTTATGGGTG
NM_153840.2       GTTCCATCACATGGCCCAGCATTTGATGATGGCTGTTGGATTTTGCCTGGGTTATGGGTG
                  ************************************************************

HsCD00295179      CCCTCTCATTATATCTGTCATTACCATTGCTGTCACGCAACCTAGCAATACCTACAAAAG
NM_153840.2       CCCTCTCATTATATCTGTCATTACCATTGCTGTCACGCAACCTAGCAATACCTACAAAAG
                  ************************************************************

HsCD00295179      GAAAGATGTGTGTTGGCTTAACTGGTCCAATGGAAGCAAACCACTCCTGGCTTTTGTTGT
NM_153840.2       GAAAGATGTGTGTTGGCTTAACTGGTCCAATGGAAGCAAACCACTCCTGGCTTTTGTTGT
                  ************************************************************

HsCD00295179      CCCTGCACTGGCTATTGTGGCTGTGAACTTCGTTGTGGTGCTGCTAGTTCTCACAAAGCT
NM_153840.2       CCCTGCACTGGCTATTGTGGCTGTGAACTTCGTTGTGGTGCTGCTAGTTCTCACAAAGCT
                  ************************************************************

HsCD00295179      CTGGAGGCCGACTGTTGGGGAAAGACTGAGTCGGGATGACAAGGCCACCATCATCCGCGT
NM_153840.2       CTGGAGGCCGACTGTTGGGGAAAGACTGAGTCGGGATGACAAGGCCACCATCATCCGCGT
                  ************************************************************

HsCD00295179      GGGGAAGAGCCTCCTCATTCTGACCCCTCTGCTAGGGCTCACCTGGGGCTTTGGAATAGG
NM_153840.2       GGGGAAGAGCCTCCTCATTCTGACCCCTCTGCTAGGGCTCACCTGGGGCTTTGGAATAGG
                  ************************************************************

HsCD00295179      AACAATAGTGGACAGCCAGAATCTGGCTTGGCATGTTATTTTTGCTTTACTCAATGCATT
NM_153840.2       AACAATAGTGGACAGCCAGAATCTGGCTTGGCATGTTATTTTTGCTTTACTCAATGCATT
                  ************************************************************

HsCD00295179      CCAGGGATTTTTTATCTTATGCTTTGGAATACTCTTGGACAGTAAGCTGCGACAACTTCT
NM_153840.2       CCAGGGATTTTTTATCTTATGCTTTGGAATACTCTTGGACAGTAAGCTGCGACAACTTCT
                  ************************************************************

HsCD00295179      GTTCAACAAGTTGTCTGCCTTAAGTTCTTGGAAGCAAACAGAAAAGCAAAACTCATCAGA
NM_153840.2       GTTCAACAAGTTGTCTGCCTTAAGTTCTTGGAAGCAAACAGAAAAGCAAAACTCATCAGA
                  ************************************************************

HsCD00295179      TTTATCTGCCAAACCCAAATTCTCAAAGCCTTTCAACCCACTGCAAAACAAAGGCCATTA
NM_153840.2       TTTATCTGCCAAACCCAAATTCTCAAAGCCTTTCAACCCACTGCAAAACAAAGGCCATTA
                  ************************************************************

HsCD00295179      TGCATTTTCTCATACTGGAGATTCCTCCGACAACATCATGCTAACTCAGTTTGTCTCAAA
NM_153840.2       TGCATTTTCTCATACTGGAGATTCCTCCGACAACATCATGCTAACTCAGTTTGTCTCAAA
                  ************************************************************

HsCD00295179      TGAATAGGGCCTCATGGGCCCAGCTTTCTTGTAC
NM_153840.2       TGAATAA---------------------------
                  ******.                           

Protein

SMART domain : GPS : G-protein-coupled receptor proteolytic site domain
UniProt : A0PJH0
UniProt : Q5T601
HPRD : 08661

Clone

Cloning Information : 481434
HIP Master Clone ID : 399162
IMAGE ID : 100063952
Original Clone ID : FLH481434.01X

Organism


TAX_ID : 9606
Species Specific ID: 266977

Genome

Chromosome : 6
Map Location : 6p12.3
Ensembl : ENSG00000153292

Reagents

Labome : GPR110-antibody