DNASU Plasmid Repository • 480.965.5697 | Email

RAD52 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RAD52
Gene Name:  RAD52 homolog (S. cerevisiae)
Sequence             
Original Clone ID: FLH481826.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00295484

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1257nts         Open reading frame : 35 to 1257
Reference Sequence Alignment

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGTCTGGGACTGAGGAAGCAATTCT
TGGAGGACGTGACAGCCATCCTGCTGCTGGCGGCGGCTCAGTGTTATGCTTTGGACAGTG
CCAGTACACAGCAGAAGAGTACCAGGCCATCCAGAAGGCCCTGAGGCAGAGGCTGGGCCC
AGAATACATAAGTAGCCGCATGGCTGGCGGAGGCCAGAAGGTGTGCTACATTGAGGGTCA
TCGGGTAATTAATCTGGCCAATGAGATGTTTGGTTACAATGGCTGGGCACACTCCATCAC
GCAGCAGAATGTGGATTTTGTTGACCTCAACAATGGCAAGTTCTACGTGGGAGTCTGTGC
ATTTGTGAGGGTCCAGCTGAAGGATGGTTCATATCATGAAGATGTTGGTTATGGTGTTAG
TGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAGAAGGCAAGGAAGGAGGCGGTGACAGA
CGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAATGCACTTGGAAACTGTATTCTGGACAA
AGACTACCTGAGATCACTAAATAAGCTTCCACGCCAGTTGCCTCTTGAAGTGGATTTAAC
TAAAGCGAAGAGACAAGATCTTGAACCGTCTGTGGAGGAGGCAAGATACAACAGCTGCCG
ACCGAACATGGCCCTGGGACACCCACAGCTGCAGCAGGTGACCTCCCCTTCCAGACCCAG
CCATGCTGTGATACCGGCGGACCAGGACTGCAGCTCCCGAAGCCTGAGCTCATCCGCCGT
GGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGGCAGAAGCAGCTGCAGCAGCAGTTCCG
GGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCCACGCCGTCAGCTGAGAAGAGTGAGGC
AGCGCCTCCGGCCCCTCCTGTGACGCACAGCACTCCTGTAACTGTCTCAGAACCACTCCT
GGAGAAAGACTTCCTTGCAGGAGTGACTCAAGAATTAATCAAGACTCTTGAAGACAACTC
TGAAAAGTGGGCTGTGACTCCCGATGCAGGGGATGGTGTGGTCAAGCCCTCGTCTAGAGC
AGACCCAGCCCAGACCTCTGACACATTAGCCTTGAACAACCAGATGGTGACCCAGAACAG
GACTCCACACAGCGTTTGCCACCAGAAACCACAAGCAAAATCTGGATCTTGGGACCTCCA
AACTTATAGCGCTGACCAACGCACAACAGGAAACTGGGAATCTCATAGGAAGAGCCAGGA
CATGAAGAAAAGGAAATATGATCCATCTTAGGGCCTCATGGGCCCAGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1371
Start on reference sequence 115
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TAAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RAD52
Symbol Nomenclature : RAD52
SYNONYM : RP11-359B12.2
Designation : DNA repair protein RAD52 homolog|recombination protein RAD52|rhabdomyosarcoma antigen MU-RMS-40.23
Full Nomenclature : RAD52 homolog (S. cerevisiae)
GENEID : 5893
GI : 182887864
GenBank Accession : BC160123
HGNC : 9824
MIM : 600392
Vega : OTTHUMG00000090361
Target GenBank: NM_134424.2

 

Reference Sequence Alignment

  

HsCD00295484        GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGTCTGGGACTGAGGAAGCAATTCT
NM_134424.2         ----------------------------------ATGTCTGGGACTGAGGAAGCAATTCT
XM_005253721.1      ----------------------------------ATGTCTGGGACTGAGGAAGCAATTCT
                                                      **************************

HsCD00295484        TGGAGGACGTGACAGCCATCCTGCTGCTGGCGGCGGCTCAGTGTTATGCTTTGGACAGTG
NM_134424.2         TGGAGGACGTGACAGCCATCCTGCTGCTGGCGGCGGCTCAGTGTTATGCTTTGGACAGTG
XM_005253721.1      TGGAGGACGTGACAGCCATCCTGCTGCTGGCGGCGGCTCAGTGTTATGCTTTGGACAGTG
                    ************************************************************

HsCD00295484        CCAGTACACAGCAGAAGAGTACCAGGCCATCCAGAAGGCCCTGAGGCAGAGGCTGGGCCC
NM_134424.2         CCAGTACACAGCAGAAGAGTACCAGGCCATCCAGAAGGCCCTGAGGCAGAGGCTGGGCCC
XM_005253721.1      CCAGTACACAGCAGAAGAGTACCAGGCCATCCAGAAGGCCCTGAGGCAGAGGCTGGGCCC
                    ************************************************************

HsCD00295484        AGAATACATAAGTAGCCGCATGGCTGGCGGAGGCCAGAAGGTGTGCTACATTGAGGGTCA
NM_134424.2         AGAATACATAAGTAGCCGCATGGCTGGCGGAGGCCAGAAGGTGTGCTACATTGAGGGTCA
XM_005253721.1      AGAATACATAAGTAGCCGCATGGCTGGCGGAGGCCAGAAGGTGTGCTACATTGAGGGTCA
                    ************************************************************

HsCD00295484        TCGGGTAATTAATCTGGCCAATGAGATGTTTGGTTACAATGGCTGGGCACACTCCATCAC
NM_134424.2         TCGGGTAATTAATCTGGCCAATGAGATGTTTGGTTACAATGGCTGGGCACACTCCATCAC
XM_005253721.1      TCGGGTAATTAATCTGGCCAATGAGATGTTTGGTTACAATGGCTGGGCACACTCCATCAC
                    ************************************************************

HsCD00295484        GCAGCAGAATGTGGATTTTGTTGACCTCAACAATGGCAAGTTCTACGTGGGAGTCTGTGC
NM_134424.2         GCAGCAGAATGTGGATTTTGTTGACCTCAACAATGGCAAGTTCTACGTGGGAGTCTGTGC
XM_005253721.1      GCAGCAGAATGTGGATTTTGTTGACCTCAACAATGGCAAGTTCTACGTGGGAGTCTGTGC
                    ************************************************************

HsCD00295484        ATTTGTGAGGGTCCAGCTGAAGGATGGTTCATATCATGAAGATGTTGGTTATGGTGTTAG
NM_134424.2         ATTTGTGAGGGTCCAGCTGAAGGATGGTTCATATCATGAAGATGTTGGTTATGGTGTTAG
XM_005253721.1      ATTTGTGAGGGTCCAGCTGAAGGATGGTTCATATCATGAAGATGTTGGTTATGGTGTTAG
                    ************************************************************

HsCD00295484        TGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAGAAGGCAAGGAAGGAGGCGGTGACAGA
NM_134424.2         TGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAGAAGGCAAGGAAGGAGGCGGTGACAGA
XM_005253721.1      TGAGGGCCTCAAGTCCAAGGCTTTATCTTTGGAGAAGGCAAGGAAGGAGGCGGTGACAGA
                    ************************************************************

HsCD00295484        CGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAATGCACTTGGAAACTGTATTCTGGACAA
NM_134424.2         CGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAATGCACTTGGAAACTGTATTCTGGACAA
XM_005253721.1      CGGGCTGAAGCGAGCCCTCAGGAGTTTTGGGAATGCACTTGGAAACTGTATTCTGGACAA
                    ************************************************************

HsCD00295484        AGACTACCTGAGATCACTAAATAAGCTTCCACGCCAGTTGCCTCTTGAAGTGGATTTAAC
NM_134424.2         AGACTACCTGAGATCACTAAATAAGCTTCCACGCCAGTTGCCTCTTGAAGTGGATTTAAC
XM_005253721.1      AGACTACCTGAGATCACTAAATAAGCTTCCACGCCAGTTGCCTCTTGAAGTGGATTTAAC
                    ************************************************************

HsCD00295484        TAAAGCGAAGAGACAAGATCTTGAACCGTCTGTGGAGGAGGCAAGATACAACAGCTGCCG
NM_134424.2         TAAAGCGAAGAGACAAGATCTTGAACCGTCTGTGGAGGAGGCAAGATACAACAGCTGCCG
XM_005253721.1      TAAAGCGAAGAGACAAGATCTTGAACCGTCTGTGGAGGAGGCAAGATACAACAGCTGCCG
                    ************************************************************

HsCD00295484        ACCGAACATGGCCCTGGGACACCCACAGCTGCAGCAGGTGACCTCCCCTTCCAGACCCAG
NM_134424.2         ACCGAACATGGCCCTGGGACACCCACAGCTGCAGCAGGTGACCTCCCCTTCCAGACCCAG
XM_005253721.1      ACCGAACATGGCCCTGGGACACCCACAGCTGCAGCAGGTGACCTCCCCTTCCAGACCCAG
                    ************************************************************

HsCD00295484        CCATGCTGTGATACCGGCGGACCAGGACTGCAGCTCCCGAAGCCTGAGCTCATCCGCCGT
NM_134424.2         CCATGCTGTGATACCGGCGGACCAGGACTGCAGCTCCCGAAGCCTGAGCTCATCCGCCGT
XM_005253721.1      CCATGCTGTGATACCGGCGGACCAGGACTGCAGCTCCCGAAGCCTGAGCTCATCCGCCGT
                    ************************************************************

HsCD00295484        GGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGGCAGAAGCAGCTGCAGCAGCAGTTCCG
NM_134424.2         GGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGGCAGAAGCAGCTGCAGCAGCAGTTCCG
XM_005253721.1      GGAGAGCGAGGCCACGCACCAGCGGAAGCTCCGGCAGAAGCAGCTGCAGCAGCAGTTCCG
                    ************************************************************

HsCD00295484        GGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCCACGCCGTCAGCTGAGAAGAGTGAGGC
NM_134424.2         GGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCCACGCCGTCAGCTGAGAAGAGTGAGGC
XM_005253721.1      GGAGCGGATGGAGAAGCAGCAGGTTCGAGTCTCCACGCCGTCAGCTGAGAAGAGTGAGGC
                    ************************************************************

HsCD00295484        AGCGCCTCCGGCCCCTCCTGTGACGCACAGCACTCCTGTAACTGTCTCAGAACCACTCCT
NM_134424.2         AGCGCCTCCGGCCCCTCCTGTGACGCACAGCACTCCTGTAACTGTCTCAGAACCACTCCT
XM_005253721.1      AGCGCCTCCGGCCCCTCCTGTGACGCACAGCACTCCTGTAACTGTCTCAGAACCACTCCT
                    ************************************************************

HsCD00295484        GGAGAAAGACTTCCTTGCAGGAGTGACTCAAGAATTAATCAAGACTCTTGAAGACAACTC
NM_134424.2         GGAGAAAGACTTCCTTGCAGGAGTGACTCAAGAATTAATCAAGACTCTTGAAGACAACTC
XM_005253721.1      GGAGAAAGACTTCCTTGCAGGAGTGACTCAAGAATTAATCAAGACTCTTGAAGACAACTC
                    ************************************************************

HsCD00295484        TGAAAAGTGGGCTGTGACTCCCGATGCAGGGGATGGTGTGGTCAAGCCCTCGTCTAGAGC
NM_134424.2         TGAAAAGTGGGCTGTGACTCCCGATGCAGGGGATGGTGTGGTCAAGCCCTCGTCTAGAGC
XM_005253721.1      TGAAAAGTGGGCTGTGACTCCCGATGCAGGGGATGGTGTGGTCAAGCCCTCGTCTAGAGC
                    ************************************************************

HsCD00295484        AGACCCAGCCCAGACCTCTGACACATTAGCCTTGAACAACCAGATGGTGACCCAGAACAG
NM_134424.2         AGACCCAGCCCAGACCTCTGACACATTAGCCTTGAACAACCAGATGGTGACCCAGAACAG
XM_005253721.1      AGACCCAGCCCAGACCTCTGACACATTAGCCTTGAACAACCAGATGGTGACCCAGAACAG
                    ************************************************************

HsCD00295484        GACTCCACACAGCGTTTGCCACCAGAAACCACAAGCAAAATCTGGATCTTGGGACCTCCA
NM_134424.2         GACTCCACACAGCGTTTGCCACCAGAAACCACAAGCAAAATCTGGATCTTGGGACCTCCA
XM_005253721.1      GACTCCACACAGCGTTTGCCACCAGAAACCACAAGCAAAATCTGGATCTTGGGACCTCCA
                    ************************************************************

HsCD00295484        AACTTATAGCGCTGACCAACGCACAACAGGAAACTGGGAATCTCATAGGAAGAGCCAGGA
NM_134424.2         AACTTATAGCGCTGACCAACGCACAACAGGAAACTGGGAATCTCATAGGAAGAGCCAGGA
XM_005253721.1      AACTTATAGCGCTGACCAACGCACAACAGGAAACTGGGAATCTCATAGGAAGAGCCAGGA
                    ************************************************************

HsCD00295484        CATGAAGAAAAGGAAATATGATCCATCTTAGGGCCTCATGGGCCCAGCTTTCTTGTAC
NM_134424.2         CATGAAGAAAAGGAAATATGATCCATCTTAA---------------------------
XM_005253721.1      CATGAAGAAAAGGAAATATGATCCATCTTAA---------------------------
                    ******************************.                           

Pathways

Reactome : Assembly of the RAD51-ssDNA nucleoprotein complex
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Homologous DNA pairing and strand exchange
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Presynaptic phase of homologous DNA pairing and strand exchange
WikiPathway : DNA damage response
WikiPathway : Homologous recombination
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

UniProt : Q3MI84
UniProt : Q5DR82
UniProt : P43351
HPRD : 11855

Clone

Cloning Information : 481826
HIP Master Clone ID : 399554
IMAGE ID : 100064155
Original Clone ID : FLH481826.01X

Organism


TAX_ID : 9606
Species Specific ID: 5893

Genome

Chromosome : 12
Map Location : 12p13-p12.2
Ensembl : ENSG00000002016

Reagents

Labome : RAD52-antibody