DNASU Plasmid Repository • 480.965.5697 | Email

HOXD11 (Homo sapiens) in pENTR223.1 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HOXD11
Gene Name:  homeobox D11
Sequence             
Original Clone ID: FLH481838.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223.1               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00295496

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1017nts         Open reading frame : 35 to 1017
Reference Sequence Alignment

GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAACGACTTTGACGAGTGCGGCCA
GAGCGCAGCCAGCATGTACCTGCCGGGCTGCGCCTACTATGTGGCCCCGTCTGACTTCGC
TAGCAAGCCTTCGTTCCTTTCCCAACCGTCGTCCTGCCAGATGACTTTCCCCTACTCTTC
CAACCTGGCTCCGCACGTCCAGCCCGTGCGCGAAGTGGCCTTCCGCGACTACGGCCTGGA
GCGCGCCAAGTGGCCGTACCGCGGCGGCGGCGGCGGCGGCAGCGCGGGGGGCGGCAGCAG
CGGGGGCGGCCCCGGCGGGGGCGGCGGCGGCGCGGGGGGCTACGCTCCCTACTACGCGGC
GGCGGCGGCGGCGGCTGCGGCGGCCGCGGCGGCCGAGGAGGCGGCCATGCAACGCGAGCT
TCTCCCGCCCGCGGGCCGCCGGCCGGACGTGCTCTTCAAGGCGCCTGAGCCGGTGTGCGC
TGCGCCGGGGCCGCCGCACGGCCCCGCGGGCGCCGCCTCCAACTTCTACAGCGCGGTGGG
CCGCAATGGCATCTTGCCACAGGGCTTCGACCAGTTCTACGAGGCAGCGCCCGGGCCCCC
GTTCGCCGGGCCGCAGCCCCCGCCGCCACCCGCGCCGCCACAGCCCGAGGGCGCAGCCGA
CAAGGGCGACCCCAGGACCGGGGCTGGTGGCGGCGGGGGCAGTCCCTGCACCAAGGCGAC
CCCTGGCTCGGAGCCCAAGGGGGCAGCAGAAGGCAGCGGTGGCGACGGCGAGGGCCCCCC
GGGAGAGGCGGGGGCCGAGAAGAGCAGCAGCGCAGTTGCCCCCCAGCGGTCCCGGAAAAA
GCGCTGTCCCTATACCAAGTACCAGATCCGCGAACTGGAACGCGAGTTTTTCTTTAACGT
GTACATAAACAAAGAGAAAAGACTTCAACTCTCTCGGATGCTCAACCTCACTGACCGGCA
AGTCAAAATCTGGTTCCAGAATCGCAGGATGAAAGAAAAGAAACTGAACAGAGACCGTCT
GCAGTATTTCACTGGAAACCCCTTATTTTAGGGCCTCATGGGCCCAGCTTTCTTGTAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1017
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
gtacaaaaaagcagaagGGCCGTCAAGGCCCACC

3' Linker Sequence:
TAAGGCCTCATGGgcccagctttcttg

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223.1

pENTR223.1 in advanced viewed

Synonyms: pDONR-223.1, pENTR223-star-Sfi
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php
Size (bp): 4311
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (Sfi sites flank the cassette present only in no insert form) 1265 1277
bacterial origin ori bacterial origin of replication 1 534
negative selection marker ccdB ccdB (no insert form only; lost in with insert form) 1312 1617
primer site M13 F M13 forward primer for insert sequencing 1113 1129
primer site T7 T7 Forward primer for insert sequencing 2902 2921
primer site M13 reverse M13 reverse primer for insert sequencing 2926 2942
recombination site attL1 attL1 recombination site 1165 1264
recombination site attL2 attL2 recombination site 2786 2885
selectable marker SpnR spectinomycin resistance gene 3154 4164
selectable marker CmR chlR (no insert form only; lost in with insert form) 1959 2618

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HOXD11
Symbol Nomenclature : HOXD11
SYNONYM : HOX4; HOX4F
Designation : Hox-4.6, mouse, homolog of|homeo box 4F|homeo box D11|homeobox protein Hox-4F|homeobox protein Hox-D11
Full Nomenclature : homeobox D11
GENEID : 3237
GI : 182887872
GenBank Accession : BC160135
HGNC : 5134
MIM : 142986
Target GenBank: NM_021192.2

 

Reference Sequence Alignment

  

HsCD00295496      GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGAACGACTTTGACGAGTGCGGCCA
NM_021192.2       ----------------------------------ATGAACGACTTTGACGAGTGCGGCCA
                                                    **************************

HsCD00295496      GAGCGCAGCCAGCATGTACCTGCCGGGCTGCGCCTACTATGTGGCCCCGTCTGACTTCGC
NM_021192.2       GAGCGCAGCCAGCATGTACCTGCCGGGCTGCGCCTACTATGTGGCCCCGTCTGACTTCGC
                  ************************************************************

HsCD00295496      TAGCAAGCCTTCGTTCCTTTCCCAACCGTCGTCCTGCCAGATGACTTTCCCCTACTCTTC
NM_021192.2       TAGCAAGCCTTCGTTCCTTTCCCAACCGTCGTCCTGCCAGATGACTTTCCCCTACTCTTC
                  ************************************************************

HsCD00295496      CAACCTGGCTCCGCACGTCCAGCCCGTGCGCGAAGTGGCCTTCCGCGACTACGGCCTGGA
NM_021192.2       CAACCTGGCTCCGCACGTCCAGCCCGTGCGCGAAGTGGCCTTCCGCGACTACGGCCTGGA
                  ************************************************************

HsCD00295496      GCGCGCCAAGTGGCCGTACCGCGGCGGCGGCGGCGGCGGCAGCGCGGGGGGCGGCAGCAG
NM_021192.2       GCGCGCCAAGTGGCCGTACCGCGGCGGCGGCGGCGGCGGCAGCGCGGGGGGCGGCAGCAG
                  ************************************************************

HsCD00295496      CGGGGGCGGCCCCGGCGGGGGCGGCGGCGGCGCGGGGGGCTACGCTCCCTACTACGCGGC
NM_021192.2       CGGGGGCGGCCCCGGCGGGGGCGGCGGCGGCGCGGGGGGCTACGCTCCCTACTACGCGGC
                  ************************************************************

HsCD00295496      GGCGGCGGCGGCGGCTGCGGCGGCCGCGGCGGCCGAGGAGGCGGCCATGCAACGCGAGCT
NM_021192.2       GGCGGCGGCGGCGGCTGCGGCGGCCGCGGCGGCCGAGGAGGCGGCCATGCAACGCGAGCT
                  ************************************************************

HsCD00295496      TCTCCCGCCCGCGGGCCGCCGGCCGGACGTGCTCTTCAAGGCGCCTGAGCCGGTGTGCGC
NM_021192.2       TCTCCCGCCCGCGGGCCGCCGGCCGGACGTGCTCTTCAAGGCGCCTGAGCCGGTGTGCGC
                  ************************************************************

HsCD00295496      TGCGCCGGGGCCGCCGCACGGCCCCGCGGGCGCCGCCTCCAACTTCTACAGCGCGGTGGG
NM_021192.2       TGCGCCGGGGCCGCCGCACGGCCCCGCGGGCGCCGCCTCCAACTTCTACAGCGCGGTGGG
                  ************************************************************

HsCD00295496      CCGCAATGGCATCTTGCCACAGGGCTTCGACCAGTTCTACGAGGCAGCGCCCGGGCCCCC
NM_021192.2       CCGCAATGGCATCTTGCCACAGGGCTTCGACCAGTTCTACGAGGCAGCGCCCGGGCCCCC
                  ************************************************************

HsCD00295496      GTTCGCCGGGCCGCAGCCCCCGCCGCCACCCGCGCCGCCACAGCCCGAGGGCGCAGCCGA
NM_021192.2       GTTCGCCGGGCCGCAGCCCCCGCCGCCACCCGCGCCGCCACAGCCCGAGGGCGCAGCCGA
                  ************************************************************

HsCD00295496      CAAGGGCGACCCCAGGACCGGGGCTGGTGGCGGCGGGGGCAGTCCCTGCACCAAGGCGAC
NM_021192.2       CAAGGGCGACCCCAGGACCGGGGCTGGTGGCGGCGGGGGCAGTCCCTGCACCAAGGCGAC
                  ************************************************************

HsCD00295496      CCCTGGCTCGGAGCCCAAGGGGGCAGCAGAAGGCAGCGGTGGCGACGGCGAGGGCCCCCC
NM_021192.2       CCCTGGCTCGGAGCCCAAGGGGGCAGCAGAAGGCAGCGGTGGCGACGGCGAGGGCCCCCC
                  ************************************************************

HsCD00295496      GGGAGAGGCGGGGGCCGAGAAGAGCAGCAGCGCAGTTGCCCCCCAGCGGTCCCGGAAAAA
NM_021192.2       GGGAGAGGCGGGGGCCGAGAAGAGCAGCAGCGCAGTTGCCCCCCAGCGGTCCCGGAAAAA
                  ************************************************************

HsCD00295496      GCGCTGTCCCTATACCAAGTACCAGATCCGCGAACTGGAACGCGAGTTTTTCTTTAACGT
NM_021192.2       GCGCTGTCCCTATACCAAGTACCAGATCCGCGAACTGGAACGCGAGTTTTTCTTTAACGT
                  ************************************************************

HsCD00295496      GTACATAAACAAAGAGAAAAGACTTCAACTCTCTCGGATGCTCAACCTCACTGACCGGCA
NM_021192.2       GTACATAAACAAAGAGAAAAGACTTCAACTCTCTCGGATGCTCAACCTCACTGACCGGCA
                  ************************************************************

HsCD00295496      AGTCAAAATCTGGTTCCAGAATCGCAGGATGAAAGAAAAGAAACTGAACAGAGACCGTCT
NM_021192.2       AGTCAAAATCTGGTTCCAGAATCGCAGGATGAAAGAAAAGAAACTGAACAGAGACCGTCT
                  ************************************************************

HsCD00295496      GCAGTATTTCACTGGAAACCCCTTATTTTAGGGCCTCATGGGCCCAGCTTTCTTGTAC
NM_021192.2       GCAGTATTTCACTGGAAACCCCTTATTTTGA---------------------------
                  *****************************..                           

Protein

SMART domain : HOX : Homeodomain
UniProt : P31277
HPRD : 00869

Clone

Cloning Information : 481838
HIP Master Clone ID : 399566
IMAGE ID : 100064167
Original Clone ID : FLH481838.01X

Organism


TAX_ID : 9606
Species Specific ID: 3237

Genome

Chromosome : 2
Map Location : 2q31.1

Reagents

Labome : HOXD11-antibody