DNASU Plasmid Repository • 480.965.5697 | Email

PTPRU (Homo sapiens) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PTPRU
Gene Name:  protein tyrosine phosphatase, receptor type, U
Sequence             
Original Clone ID: 8709a13BCt10p1
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: C-terminal 6-His, TOPO
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00297779

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 882nts        
Open reading frame : 47 to 928
Reference Sequence Alignment

TCTAAATATTTTGTTTACTTTAGAAGGAGATATACATATGTCCCTTGCGGTGCGTGTCGC
AGACCTTCTGCAGCACATCAACCAGATGAAGACGGCCGAGGGTTACGGCTTCAAGCAGGA
GTATGAGAGCTTCTTTGAAGGCTGGGACGCCACAAAGAAGAAAGACAAGGTCAAGGGCAG
CCGGCAGGAGCCAATGCCTGCCTATGATCGGCACCGAGTGAAACTGCACCCGATGCTGGG
AGACCCCAGTGCCGACTACATTAATGCCAACTACATAGATGGTTACCACAGGTCAAACCA
CTTCATAGCCACTCAAGGGCCGAAGCCTGAGATGGTCTATGACTTCTGGCGTATGGTGTG
GCAGGAGCACTGTTCCAGCATCGTCATGATCACCAAGCTGGTCGAGGTGGGCAGGGTGAA
ATGCTCACGGTACTGGCCGGAGGACTCAGACACCTACGGGGACATCAAGATTATGCTGGT
GAAGACAGAGACCCTGGCTGAGTATGTCGTGCGCACTTTTGCCCTGGAGCGGAGAGGCTA
CTCTGCCCGGCACGAGGTCCGCCAGTTCCACTTCACAGCGTGGCCAGAGCATGGCGTCCC
CTACCATGCCACGGGGCTGCTGGCTTTCATCCGGCGCGTGAAGGCCTCCACCCCACCTGA
TGCCGGGCCCATTGTCATCCACTGCAGCGCGGGCACCGGCCGCACAGGTTGCTATATCGT
CCTGGATGTGATGCTGGACATGGCAGAGTGTGAGGGCGTCGTGGACATTTACAACTGTGT
GAAGACTCTCTGCTCCCGGCGTGTCAACATGATCCAGACTGAGGAGCAGTACATCTTCAT
TCATGATGCAATCCTGGAGGCCTGCCTGTGTGGGGAGACCACCATCCCTGTCAGTGAGTT
CGAAGGGCATCATCACCATCACCACTGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGG
CCGCACTCGAGCACCAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 1
End on reference sequence 882
Mutations:
None
Discrepancy:
"a203g,N68S;"
                                

5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
SolubleProtein: Protein_Soluble
ProteinPurified: Tested_Not_Purified
Find experimental protocols in NYSGXRC-8709a
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PTPRU
Symbol Nomenclature : PTPRU
SYNONYM : FMI; PCP-2; PTP; PTP-J; PTP-PI; PTP-RO; PTPPSI; PTPRO; PTPU2; R-PTP-PSI; R-PTP-U; hPTP-J
Designation : PTP pi|Receptor protein tyrosine phosphatase hPTP-J|pancreatic carcinoma phosphatase 2|pi R-PTP-Psi|protein tyrosine phosphatase J|protein tyrosine phosphatase receptor omicron|protein-tyrosine phosphatase J|protein-tyrosine phosphatase pi|protein-tyrosine phosphatase receptor omicron|receptor-type protein-tyrosine phosphatase psi|receptor-type tyrosine-protein phosphatase U
Full Nomenclature : protein tyrosine phosphatase, receptor type, U
GENEID : 10076
GenBank Accession : NP_573439
HGNC : 9683
MIM : 602454
Vega : OTTHUMG00000003699
Target GenBank: NP_573439

 

Reference Sequence Alignment

  

HsCD00297779        ------------------------------------------------------------
NM_133177.3         ATGGCCCGTGCCCAGGCGCTCGTGCTGGCACTCACCTTCCAGCTCTGCGCGCCGGAGACC
NM_001195001.1      ATGGCCCGTGCCCAGGCGCTCGTGCTGGCACTCACCTTCCAGCTCTGCGCGCCGGAGACC
NM_133178.3         ATGGCCCGTGCCCAGGCGCTCGTGCTGGCACTCACCTTCCAGCTCTGCGCGCCGGAGACC
NM_005704.4         ATGGCCCGTGCCCAGGCGCTCGTGCTGGCACTCACCTTCCAGCTCTGCGCGCCGGAGACC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         GAGACTCCGGCAGCTGGCTGCACCTTCGAGGAGGCAAGTGACCCAGCAGTGCCCTGCGAG
NM_001195001.1      GAGACTCCGGCAGCTGGCTGCACCTTCGAGGAGGCAAGTGACCCAGCAGTGCCCTGCGAG
NM_133178.3         GAGACTCCGGCAGCTGGCTGCACCTTCGAGGAGGCAAGTGACCCAGCAGTGCCCTGCGAG
NM_005704.4         GAGACTCCGGCAGCTGGCTGCACCTTCGAGGAGGCAAGTGACCCAGCAGTGCCCTGCGAG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         TACAGCCAGGCCCAGTACGATGACTTCCAGTGGGAGCAAGTGCGAATCCACCCTGGCACC
NM_001195001.1      TACAGCCAGGCCCAGTACGATGACTTCCAGTGGGAGCAAGTGCGAATCCACCCTGGCACC
NM_133178.3         TACAGCCAGGCCCAGTACGATGACTTCCAGTGGGAGCAAGTGCGAATCCACCCTGGCACC
NM_005704.4         TACAGCCAGGCCCAGTACGATGACTTCCAGTGGGAGCAAGTGCGAATCCACCCTGGCACC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CGGGCACCTGCGGACCTGCCCCACGGCTCCTACTTGATGGTCAACACTTCCCAGCATGCC
NM_001195001.1      CGGGCACCTGCGGACCTGCCCCACGGCTCCTACTTGATGGTCAACACTTCCCAGCATGCC
NM_133178.3         CGGGCACCTGCGGACCTGCCCCACGGCTCCTACTTGATGGTCAACACTTCCCAGCATGCC
NM_005704.4         CGGGCACCTGCGGACCTGCCCCACGGCTCCTACTTGATGGTCAACACTTCCCAGCATGCC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CCAGGCCAGCGAGCCCATGTCATCTTCCAGAGCCTGAGCGAGAATGATACCCACTGTGTG
NM_001195001.1      CCAGGCCAGCGAGCCCATGTCATCTTCCAGAGCCTGAGCGAGAATGATACCCACTGTGTG
NM_133178.3         CCAGGCCAGCGAGCCCATGTCATCTTCCAGAGCCTGAGCGAGAATGATACCCACTGTGTG
NM_005704.4         CCAGGCCAGCGAGCCCATGTCATCTTCCAGAGCCTGAGCGAGAATGATACCCACTGTGTG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CAGTTCAGCTACTTCCTGTACAGCCGGGACGGGCACAGCCCGGGCACCCTGGGCGTCTAC
NM_001195001.1      CAGTTCAGCTACTTCCTGTACAGCCGGGACGGGCACAGCCCGGGCACCCTGGGCGTCTAC
NM_133178.3         CAGTTCAGCTACTTCCTGTACAGCCGGGACGGGCACAGCCCGGGCACCCTGGGCGTCTAC
NM_005704.4         CAGTTCAGCTACTTCCTGTACAGCCGGGACGGGCACAGCCCGGGCACCCTGGGCGTCTAC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         GTGCGCGTTAATGGGGGCCCCCTGGGCAGTGCTGTGTGGAATATGACTGGATCCCACGGC
NM_001195001.1      GTGCGCGTTAATGGGGGCCCCCTGGGCAGTGCTGTGTGGAATATGACTGGATCCCACGGC
NM_133178.3         GTGCGCGTTAATGGGGGCCCCCTGGGCAGTGCTGTGTGGAATATGACTGGATCCCACGGC
NM_005704.4         GTGCGCGTTAATGGGGGCCCCCTGGGCAGTGCTGTGTGGAATATGACTGGATCCCACGGC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CGTCAGTGGCACCAGGCTGAGCTGGCTGTCAGCACTTTCTGGCCCAATGAATATCAGGTG
NM_001195001.1      CGTCAGTGGCACCAGGCTGAGCTGGCTGTCAGCACTTTCTGGCCCAATGAATATCAGGTG
NM_133178.3         CGTCAGTGGCACCAGGCTGAGCTGGCTGTCAGCACTTTCTGGCCCAATGAATATCAGGTG
NM_005704.4         CGTCAGTGGCACCAGGCTGAGCTGGCTGTCAGCACTTTCTGGCCCAATGAATATCAGGTG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CTGTTTGAGGCCCTCATCTCCCCAGACCGCAGGGGCTACATGGGCCTAGATGACATCCTG
NM_001195001.1      CTGTTTGAGGCCCTCATCTCCCCAGACCGCAGGGGCTACATGGGCCTAGATGACATCCTG
NM_133178.3         CTGTTTGAGGCCCTCATCTCCCCAGACCGCAGGGGCTACATGGGCCTAGATGACATCCTG
NM_005704.4         CTGTTTGAGGCCCTCATCTCCCCAGACCGCAGGGGCTACATGGGCCTAGATGACATCCTG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CTTCTCAGCTACCCCTGCGCAAAGGCCCCACACTTCTCCCGCCTGGGCGACGTGGAGGTC
NM_001195001.1      CTTCTCAGCTACCCCTGCGCAAAGGCCCCACACTTCTCCCGCCTGGGCGACGTGGAGGTC
NM_133178.3         CTTCTCAGCTACCCCTGCGCAAAGGCCCCACACTTCTCCCGCCTGGGCGACGTGGAGGTC
NM_005704.4         CTTCTCAGCTACCCCTGCGCAAAGGCCCCACACTTCTCCCGCCTGGGCGACGTGGAGGTC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         AACGCGGGCCAGAACGCGTCGTTCCAGTGCATGGCCGCGGGCAGAGCGGCCGAGGCCGAA
NM_001195001.1      AACGCGGGCCAGAACGCGTCGTTCCAGTGCATGGCCGCGGGCAGAGCGGCCGAGGCCGAA
NM_133178.3         AACGCGGGCCAGAACGCGTCGTTCCAGTGCATGGCCGCGGGCAGAGCGGCCGAGGCCGAA
NM_005704.4         AACGCGGGCCAGAACGCGTCGTTCCAGTGCATGGCCGCGGGCAGAGCGGCCGAGGCCGAA
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CGCTTCCTCTTGCAACGGCAGAGCGGGGCGCTGGTGCCGGCGGCGGGCGTGCGGCACATC
NM_001195001.1      CGCTTCCTCTTGCAACGGCAGAGCGGGGCGCTGGTGCCGGCGGCGGGCGTGCGGCACATC
NM_133178.3         CGCTTCCTCTTGCAACGGCAGAGCGGGGCGCTGGTGCCGGCGGCGGGCGTGCGGCACATC
NM_005704.4         CGCTTCCTCTTGCAACGGCAGAGCGGGGCGCTGGTGCCGGCGGCGGGCGTGCGGCACATC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         AGCCACCGGCGCTTCCTGGCCACTTTCCCGCTGGCTGCCGTGAGCCGCGCCGAGCAGGAC
NM_001195001.1      AGCCACCGGCGCTTCCTGGCCACTTTCCCGCTGGCTGCCGTGAGCCGCGCCGAGCAGGAC
NM_133178.3         AGCCACCGGCGCTTCCTGGCCACTTTCCCGCTGGCTGCCGTGAGCCGCGCCGAGCAGGAC
NM_005704.4         AGCCACCGGCGCTTCCTGGCCACTTTCCCGCTGGCTGCCGTGAGCCGCGCCGAGCAGGAC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CTGTACCGCTGTGTGTCCCAGGCCCCGCGCGGCGCGGGCGTCTCTAACTTCGCGGAGCTC
NM_001195001.1      CTGTACCGCTGTGTGTCCCAGGCCCCGCGCGGCGCGGGCGTCTCTAACTTCGCGGAGCTC
NM_133178.3         CTGTACCGCTGTGTGTCCCAGGCCCCGCGCGGCGCGGGCGTCTCTAACTTCGCGGAGCTC
NM_005704.4         CTGTACCGCTGTGTGTCCCAGGCCCCGCGCGGCGCGGGCGTCTCTAACTTCGCGGAGCTC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         ATCGTCAAGGAGCCCCCAACTCCCATCGCGCCCCCACAGCTGCTGCGTGCTGGCCCCACC
NM_001195001.1      ATCGTCAAGGAGCCCCCAACTCCCATCGCGCCCCCACAGCTGCTGCGTGCTGGCCCCACC
NM_133178.3         ATCGTCAAGGAGCCCCCAACTCCCATCGCGCCCCCACAGCTGCTGCGTGCTGGCCCCACC
NM_005704.4         ATCGTCAAGGAGCCCCCAACTCCCATCGCGCCCCCACAGCTGCTGCGTGCTGGCCCCACC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         TACCTCATCATCCAGCTCAACACCAACTCCATCATTGGCGACGGGCCGATCGTGCGCAAG
NM_001195001.1      TACCTCATCATCCAGCTCAACACCAACTCCATCATTGGCGACGGGCCGATCGTGCGCAAG
NM_133178.3         TACCTCATCATCCAGCTCAACACCAACTCCATCATTGGCGACGGGCCGATCGTGCGCAAG
NM_005704.4         TACCTCATCATCCAGCTCAACACCAACTCCATCATTGGCGACGGGCCGATCGTGCGCAAG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         GAGATTGAGTACCGCATGGCGCGCGGGCCCTGGGCTGAGGTGCACGCCGTCAGCCTGCAG
NM_001195001.1      GAGATTGAGTACCGCATGGCGCGCGGGCCCTGGGCTGAGGTGCACGCCGTCAGCCTGCAG
NM_133178.3         GAGATTGAGTACCGCATGGCGCGCGGGCCCTGGGCTGAGGTGCACGCCGTCAGCCTGCAG
NM_005704.4         GAGATTGAGTACCGCATGGCGCGCGGGCCCTGGGCTGAGGTGCACGCCGTCAGCCTGCAG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         ACCTACAAGCTGTGGCACCTCGACCCCGACACAGAGTATGAGATCAGCGTGCTGCTCACG
NM_001195001.1      ACCTACAAGCTGTGGCACCTCGACCCCGACACAGAGTATGAGATCAGCGTGCTGCTCACG
NM_133178.3         ACCTACAAGCTGTGGCACCTCGACCCCGACACAGAGTATGAGATCAGCGTGCTGCTCACG
NM_005704.4         ACCTACAAGCTGTGGCACCTCGACCCCGACACAGAGTATGAGATCAGCGTGCTGCTCACG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CGTCCCGGAGACGGCGGCACTGGCCGCCCTGGGCCACCCCTCATCAGCCGCACCAAATGC
NM_001195001.1      CGTCCCGGAGACGGCGGCACTGGCCGCCCTGGGCCACCCCTCATCAGCCGCACCAAATGC
NM_133178.3         CGTCCCGGAGACGGCGGCACTGGCCGCCCTGGGCCACCCCTCATCAGCCGCACCAAATGC
NM_005704.4         CGTCCCGGAGACGGCGGCACTGGCCGCCCTGGGCCACCCCTCATCAGCCGCACCAAATGC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         GCAGAGCCCATGAGGGCCCCCAAAGGCCTGGCTTTTGCTGAGATCCAGGCCCGTCAGCTG
NM_001195001.1      GCAGAGCCCATGAGGGCCCCCAAAGGCCTGGCTTTTGCTGAGATCCAGGCCCGTCAGCTG
NM_133178.3         GCAGAGCCCATGAGGGCCCCCAAAGGCCTGGCTTTTGCTGAGATCCAGGCCCGTCAGCTG
NM_005704.4         GCAGAGCCCATGAGGGCCCCCAAAGGCCTGGCTTTTGCTGAGATCCAGGCCCGTCAGCTG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         ACCCTGCAGTGGGAACCACTGGGCTACAACGTGACGCGTTGCCACACCTATACTGTGTCG
NM_001195001.1      ACCCTGCAGTGGGAACCACTGGGCTACAACGTGACGCGTTGCCACACCTATACTGTGTCG
NM_133178.3         ACCCTGCAGTGGGAACCACTGGGCTACAACGTGACGCGTTGCCACACCTATACTGTGTCG
NM_005704.4         ACCCTGCAGTGGGAACCACTGGGCTACAACGTGACGCGTTGCCACACCTATACTGTGTCG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CTGTGCTATCACTACACCCTGGGCAGCAGCCACAACCAGACCATCCGAGAGTGTGTGAAG
NM_001195001.1      CTGTGCTATCACTACACCCTGGGCAGCAGCCACAACCAGACCATCCGAGAGTGTGTGAAG
NM_133178.3         CTGTGCTATCACTACACCCTGGGCAGCAGCCACAACCAGACCATCCGAGAGTGTGTGAAG
NM_005704.4         CTGTGCTATCACTACACCCTGGGCAGCAGCCACAACCAGACCATCCGAGAGTGTGTGAAG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         ACAGAGCAAGGTGTCAGCCGCTACACCATCAAGAACCTGCTGCCCTATCGGAACGTTCAC
NM_001195001.1      ACAGAGCAAGGTGTCAGCCGCTACACCATCAAGAACCTGCTGCCCTATCGGAACGTTCAC
NM_133178.3         ACAGAGCAAGGTGTCAGCCGCTACACCATCAAGAACCTGCTGCCCTATCGGAACGTTCAC
NM_005704.4         ACAGAGCAAGGTGTCAGCCGCTACACCATCAAGAACCTGCTGCCCTATCGGAACGTTCAC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         GTGAGGCTTGTCCTCACTAACCCTGAGGGGCGCAAAGAGGGCAAGGAGGTCACTTTCCAG
NM_001195001.1      GTGAGGCTTGTCCTCACTAACCCTGAGGGGCGCAAAGAGGGCAAGGAGGTCACTTTCCAG
NM_133178.3         GTGAGGCTTGTCCTCACTAACCCTGAGGGGCGCAAAGAGGGCAAGGAGGTCACTTTCCAG
NM_005704.4         GTGAGGCTTGTCCTCACTAACCCTGAGGGGCGCAAAGAGGGCAAGGAGGTCACTTTCCAG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         ACGGATGAGGATGTGCCCAGTGGGATTGCAGCCGAGTCCCTGACCTTCACTCCACTGGAG
NM_001195001.1      ACGGATGAGGATGTGCCCAGTGGGATTGCAGCCGAGTCCCTGACCTTCACTCCACTGGAG
NM_133178.3         ACGGATGAGGATGTGCCCAGTGGGATTGCAGCCGAGTCCCTGACCTTCACTCCACTGGAG
NM_005704.4         ACGGATGAGGATGTGCCCAGTGGGATTGCAGCCGAGTCCCTGACCTTCACTCCACTGGAG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         GACATGATCTTCCTCAAGTGGGAGGAGCCCCAGGAGCCCAATGGTCTCATCACCCAGTAT
NM_001195001.1      GACATGATCTTCCTCAAGTGGGAGGAGCCCCAGGAGCCCAATGGTCTCATCACCCAGTAT
NM_133178.3         GACATGATCTTCCTCAAGTGGGAGGAGCCCCAGGAGCCCAATGGTCTCATCACCCAGTAT
NM_005704.4         GACATGATCTTCCTCAAGTGGGAGGAGCCCCAGGAGCCCAATGGTCTCATCACCCAGTAT
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         GAGATCAGCTACCAGAGCATCGAGTCATCAGACCCGGCAGTGAACGTGCCAGGCCCACGA
NM_001195001.1      GAGATCAGCTACCAGAGCATCGAGTCATCAGACCCGGCAGTGAACGTGCCAGGCCCACGA
NM_133178.3         GAGATCAGCTACCAGAGCATCGAGTCATCAGACCCGGCAGTGAACGTGCCAGGCCCACGA
NM_005704.4         GAGATCAGCTACCAGAGCATCGAGTCATCAGACCCGGCAGTGAACGTGCCAGGCCCACGA
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CGTACCATCTCCAAGCTCCGCAATGAGACCTACCATGTCTTCTCCAACCTGCACCCAGGC
NM_001195001.1      CGTACCATCTCCAAGCTCCGCAATGAGACCTACCATGTCTTCTCCAACCTGCACCCAGGC
NM_133178.3         CGTACCATCTCCAAGCTCCGCAATGAGACCTACCATGTCTTCTCCAACCTGCACCCAGGC
NM_005704.4         CGTACCATCTCCAAGCTCCGCAATGAGACCTACCATGTCTTCTCCAACCTGCACCCAGGC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         ACCACCTACCTGTTCTCCGTGCGGGCCCGCACAGGCAAAGGCTTCGGCCAGGCGGCACTC
NM_001195001.1      ACCACCTACCTGTTCTCCGTGCGGGCCCGCACAGGCAAAGGCTTCGGCCAGGCGGCACTC
NM_133178.3         ACCACCTACCTGTTCTCCGTGCGGGCCCGCACAGGCAAAGGCTTCGGCCAGGCGGCACTC
NM_005704.4         ACCACCTACCTGTTCTCCGTGCGGGCCCGCACAGGCAAAGGCTTCGGCCAGGCGGCACTC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         ACTGAGATAACCACTAACATCTCTGCTCCCAGCTTTGATTATGCCGACATGCCGTCACCC
NM_001195001.1      ACTGAGATAACCACTAACATCTCTGCTCCCAGCTTTGATTATGCCGACATGCCGTCACCC
NM_133178.3         ACTGAGATAACCACTAACATCTCTGCTCCCAGCTTTGATTATGCCGACATGCCGTCACCC
NM_005704.4         ACTGAGATAACCACTAACATCTCTGCTCCCAGCTTTGATTATGCCGACATGCCGTCACCC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CTGGGCGAGTCTGAGAACACCATCACCGTGCTGCTGAGGCCGGCACAGGGCCGCGGTGCG
NM_001195001.1      CTGGGCGAGTCTGAGAACACCATCACCGTGCTGCTGAGGCCGGCACAGGGCCGCGGTGCG
NM_133178.3         CTGGGCGAGTCTGAGAACACCATCACCGTGCTGCTGAGGCCGGCACAGGGCCGCGGTGCG
NM_005704.4         CTGGGCGAGTCTGAGAACACCATCACCGTGCTGCTGAGGCCGGCACAGGGCCGCGGTGCG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CCCATCAGTGTGTACCAGGTGATTGTGGAGGAGGAGCGGGCGCGGAGGCTGCGGCGGGAG
NM_001195001.1      CCCATCAGTGTGTACCAGGTGATTGTGGAGGAGGAGCGGGCGCGGAGGCTGCGGCGGGAG
NM_133178.3         CCCATCAGTGTGTACCAGGTGATTGTGGAGGAGGAGCGGGCGCGGAGGCTGCGGCGGGAG
NM_005704.4         CCCATCAGTGTGTACCAGGTGATTGTGGAGGAGGAGCGGGCGCGGAGGCTGCGGCGGGAG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CCAGGTGGACAGGACTGCTTCCCAGTGCCATTGACCTTCGAGGCGGCGCTGGCCCGAGGC
NM_001195001.1      CCAGGTGGACAGGACTGCTTCCCAGTGCCATTGACCTTCGAGGCGGCGCTGGCCCGAGGC
NM_133178.3         CCAGGTGGACAGGACTGCTTCCCAGTGCCATTGACCTTCGAGGCGGCGCTGGCCCGAGGC
NM_005704.4         CCAGGTGGACAGGACTGCTTCCCAGTGCCATTGACCTTCGAGGCGGCGCTGGCCCGAGGC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CTGGTGCACTACTTCGGGGCCGAACTGGCGGCCAGCAGTCTACCTGAGGCCATGCCCTTT
NM_001195001.1      CTGGTGCACTACTTCGGGGCCGAACTGGCGGCCAGCAGTCTACCTGAGGCCATGCCCTTT
NM_133178.3         CTGGTGCACTACTTCGGGGCCGAACTGGCGGCCAGCAGTCTACCTGAGGCCATGCCCTTT
NM_005704.4         CTGGTGCACTACTTCGGGGCCGAACTGGCGGCCAGCAGTCTACCTGAGGCCATGCCCTTT
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         ACCGTGGGTGACAACCAGACCTACCGAGGCTTCTGGAACCCACCACTTGAGCCTAGGAAG
NM_001195001.1      ACCGTGGGTGACAACCAGACCTACCGAGGCTTCTGGAACCCACCACTTGAGCCTAGGAAG
NM_133178.3         ACCGTGGGTGACAACCAGACCTACCGAGGCTTCTGGAACCCACCACTTGAGCCTAGGAAG
NM_005704.4         ACCGTGGGTGACAACCAGACCTACCGAGGCTTCTGGAACCCACCACTTGAGCCTAGGAAG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         GCCTATCTCATCTACTTCCAGGCAGCAAGCCACCTGAAGGGGGAGACCCGGCTGAATTGC
NM_001195001.1      GCCTATCTCATCTACTTCCAGGCAGCAAGCCACCTGAAGGGGGAGACCCGGCTGAATTGC
NM_133178.3         GCCTATCTCATCTACTTCCAGGCAGCAAGCCACCTGAAGGGGGAGACCCGGCTGAATTGC
NM_005704.4         GCCTATCTCATCTACTTCCAGGCAGCAAGCCACCTGAAGGGGGAGACCCGGCTGAATTGC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         ATCCGCATTGCCAGGAAAGCTGCCTGCAAGGAAAGCAAGCGGCCCCTGGAGGTGTCCCAG
NM_001195001.1      ATCCGCATTGCCAGGAAAGCTGCCTGCAAGGAAAGCAAGCGGCCCCTGGAGGTGTCCCAG
NM_133178.3         ATCCGCATTGCCAGGAAAGCTGCCTGCAAGGAAAGCAAGCGGCCCCTGGAGGTGTCCCAG
NM_005704.4         ATCCGCATTGCCAGGAAAGCTGCCTGCAAGGAAAGCAAGCGGCCCCTGGAGGTGTCCCAG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         AGATCGGAGGAGATGGGGCTTATCCTGGGCATCTGTGCAGGGGGGCTTGCTGTCCTCATC
NM_001195001.1      AGATCGGAGGAGATGGGGCTTATCCTGGGCATCTGTGCAGGGGGGCTTGCTGTCCTCATC
NM_133178.3         AGATCGGAGGAGATGGGGCTTATCCTGGGCATCTGTGCAGGGGGGCTTGCTGTCCTCATC
NM_005704.4         AGATCGGAGGAGATGGGGCTTATCCTGGGCATCTGTGCAGGGGGGCTTGCTGTCCTCATC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CTTCTCCTGGGTGCCATCATTGTCATCATCCGCAAAGG----------------------
NM_001195001.1      CTTCTCCTGGGTGCCATCATTGTCATCATCCGCAAAGG----------------------
NM_133178.3         CTTCTCCTGGGTGCCATCATTGTCATCATCCGCAAAGG----------------------
NM_005704.4         CTTCTCCTGGGTGCCATCATTGTCATCATCCGCAAAGGGAGAGACCACTATGCCTACTCC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         --------GAAGCCGGTGAACATGACCAAGGCCACCGTCAACTACCGCCAGGAGAAGACA
NM_001195001.1      --------GAAGCCGGTGAACATGACCAAGGCCACCGTCAACTACCGCCAGGAGAAGACA
NM_133178.3         --------GAAGCCGGTGAACATGACCAAGGCCACCGTCAACTACCGCCAGGAGAAGACA
NM_005704.4         TACTACCCGAAGCCGGTGAACATGACCAAGGCCACCGTCAACTACCGCCAGGAGAAGACA
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CACATGATGAGCGCCGTGGACCGCAGCTTCACAGACCAGAGCACCCTGCAGGAGGACGAG
NM_001195001.1      CACATGATGAGCGCCGTGGACCGCAGCTTCACAGACCAGAGCACCCTGCAGGAGGACGAG
NM_133178.3         CACATGATGAGCGCCGTGGACCGCAGCTTCACAGACCAGAGCACCCTGCAGGAGGACGAG
NM_005704.4         CACATGATGAGCGCCGTGGACCGCAGCTTCACAGACCAGAGCACCCTGCAGGAGGACGAG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CGGCTGGGCCTGTCCTTCATGGACACCCATGGCTACAGCACCCGGGGAGACCAGCGCAGC
NM_001195001.1      CGGCTGGGCCTGTCCTTCATGGACACCCATGGCTACAGCACCCGGGGAGACCAGCGCAGC
NM_133178.3         CGGCTGGGCCTGTCCTTCATGGACACCCATGGCTACAGCACCCGGGGAGACCAGCGCAGC
NM_005704.4         CGGCTGGGCCTGTCCTTCATGGACACCCATGGCTACAGCACCCGGGGAGACCAGCGCAGC
                                                                                

HsCD00297779        --------------------------------------------------TCTAAATATT
NM_133177.3         GGTGGGGTCACTGAGGCCAGCAGCCTCCTGGGGGGCTCCCCGAGGCGTCCCTGTGGCCGG
NM_001195001.1      GGTGGGGTCACTGAGGCCAGCAGCCTCCTGGGGGGCTCCCCGAGGCGTCCCTGTGGCCGG
NM_133178.3         GGTGGGGTCACTGAGGCCAGCAGCCTCCTGGGGGGCTCCCCGAGGCGTCCCTGTGGCCGG
NM_005704.4         GGTGGGGTCACTGAGGCCAGCAGCCTCCTGGGGGGCTCCCCGAGGCGTCCCTGTGGCCGG
                                                                         :.. .  

HsCD00297779        TTGTTTACTTTAGAAGGAGATATACATATGTCCCTTGCGGTGCGTGTCGCAGACCTTCTG
NM_133177.3         AAGGGCTCCCCATACCACACGGGGCAGCTGCACCCTGCGGTGCGTGTCGCAGACCTTCTG
NM_001195001.1      AAGGGCTCCCCATACCACACGGGGCAGCTGCACCCTGCGGTGCGTGTCGCAGACCTTCTG
NM_133178.3         AAGGGCTCCCCATACCACACGGGGCAGCTGCACCCTGCGGTGCGTGTCGCAGACCTTCTG
NM_005704.4         AAGGGCTCCCCATACCACACGGGGCAGCTGCACCCTGCGGTGCGTGTCGCAGACCTTCTG
                    ::*   :*   * *. .... . .** .** .** *************************

HsCD00297779        CAGCACATCAACCAGATGAAGACGGCCGAGGGTTACGGCTTCAAGCAGGAGTATGAGAGC
NM_133177.3         CAGCACATCAACCAGATGAAGACGGCCGAGGGTTACGGCTTCAAGCAGGAGTATGAGAGC
NM_001195001.1      CAGCACATCAACCAGATGAAGACGGCCGAGGGTTACGGCTTCAAGCAGGAGTATGAGAGC
NM_133178.3         CAGCACATCAACCAGATGAAGACGGCCGAGGGTTACGGCTTCAAGCAGGAGTATGAGAGC
NM_005704.4         CAGCACATCAACCAGATGAAGACGGCCGAGGGTTACGGCTTCAAGCAGGAGTATGAGAGC
                    ************************************************************

HsCD00297779        TTCTTTGAAGGCTGGGACGCCACAAAGAAGAAAGACAAGGTCAAGGGCAGCCGGCAGGAG
NM_133177.3         TTCTTTGAAGGCTGGGACGCCACAAAGAAGAAAGACAAGGTCAAGGGCAGCCGGCAGGAG
NM_001195001.1      TTCTTTGAAGGCTGGGACGCCACAAAGAAGAAAGACAAGGTCAAGGGCAGCCGGCAGGAG
NM_133178.3         TTCTTTGAAGGCTGGGACGCCACAAAGAAGAAAGACAAGGTCAAGGGCAGCCGGCAGGAG
NM_005704.4         TTCTTTGAAGGCTGGGACGCCACAAAGAAGAAAGACAAGGTCAAGGGCAGCCGGCAGGAG
                    ************************************************************

HsCD00297779        CCAATGCCTGCCTATGATCGGCACCGAGTGAAACTGCACCCGATGCTGGGAGACCCCAGT
NM_133177.3         CCAATGCCTGCCTATGATCGGCACCGAGTGAAACTGCACCCGATGCTGGGAGACCCCAAT
NM_001195001.1      CCAATGCCTGCCTATGATCGGCACCGAGTGAAACTGCACCCGATGCTGGGAGACCCCAAT
NM_133178.3         CCAATGCCTGCCTATGATCGGCACCGAGTGAAACTGCACCCGATGCTGGGAGACCCCAAT
NM_005704.4         CCAATGCCTGCCTATGATCGGCACCGAGTGAAACTGCACCCGATGCTGGGAGACCCCAAT
                    **********************************************************.*

HsCD00297779        GCCGACTACATTAATGCCAACTACATAGATG------------------GTTACCACAGG
NM_133177.3         GCCGACTACATTAATGCCAACTACATAGATATTCGGATAAACCGAGAAGGTTACCACAGG
NM_001195001.1      GCCGACTACATTAATGCCAACTACATAGATG------------------GTTACCACAGG
NM_133178.3         GCCGACTACATTAATGCCAACTACATAGATG------------------GTTACCACAGG
NM_005704.4         GCCGACTACATTAATGCCAACTACATAGATG------------------GTTACCACAGG
                    ******************************.                  ***********

HsCD00297779        TCAAACCACTTCATAGCCACTCAAGGGCCGAAGCCTGAGATGGTCTATGACTTCTGGCGT
NM_133177.3         TCAAACCACTTCATAGCCACTCAAGGGCCGAAGCCTGAGATGGTCTATGACTTCTGGCGT
NM_001195001.1      TCAAACCACTTCATAGCCACTCAAGGGCCGAAGCCTGAGATGGTCTATGACTTCTGGCGT
NM_133178.3         TCAAACCACTTCATAGCCACTCAAGGGCCGAAGCCTGAGATGGTCTATGACTTCTGGCGT
NM_005704.4         TCAAACCACTTCATAGCCACTCAAGGGCCGAAGCCTGAGATGGTCTATGACTTCTGGCGT
                    ************************************************************

HsCD00297779        ATGGTGTGGCAGGAGCACTGTTCCAGCATCGTCATGATCACCAAGCTGGTCGAGGTGGGC
NM_133177.3         ATGGTGTGGCAGGAGCACTGTTCCAGCATCGTCATGATCACCAAGCTGGTCGAGGTGGGC
NM_001195001.1      ATGGTGTGGCAGGAGCACTGTTCCAGCATCGTCATGATCACCAAGCTGGTCGAGGTG---
NM_133178.3         ATGGTGTGGCAGGAGCACTGTTCCAGCATCGTCATGATCACCAAGCTGGTCGAGGTGGGC
NM_005704.4         ATGGTGTGGCAGGAGCACTGTTCCAGCATCGTCATGATCACCAAGCTGGTCGAGGTGGGC
                    *********************************************************   

HsCD00297779        AGGGTGAAATGCTCACGGTACTGGCCGGAGGACTCAGACACCTACGGGGACATCAAGATT
NM_133177.3         AGGGTGAAATGCTCACGGTACTGGCCGGAGGACTCAGACACCTACGGGGACATCAAGATT
NM_001195001.1      ------AAATGCTCACGGTACTGGCCGGAGGACTCAGACACCTACGGGGACATCAAGATT
NM_133178.3         AGGGTGAAATGCTCACGGTACTGGCCGGAGGACTCAGACACCTACGGGGACATCAAGATT
NM_005704.4         AGGGTGAAATGCTCACGGTACTGGCCGGAGGACTCAGACACCTACGGGGACATCAAGATT
                          ******************************************************

HsCD00297779        ATGCTGGTGAAGACAGAGACCCTGGCTGAGTATGTCGTGCGCACTTTTGCCCTGGAGCGG
NM_133177.3         ATGCTGGTGAAGACAGAGACCCTGGCTGAGTATGTCGTGCGCACTTTTGCCCTGGAGCGG
NM_001195001.1      ATGCTGGTGAAGACAGAGACCCTGGCTGAGTATGTCGTGCGCACTTTTGCCCTGGAGCGG
NM_133178.3         ATGCTGGTGAAGACAGAGACCCTGGCTGAGTATGTCGTGCGCACTTTTGCCCTGGAGCGG
NM_005704.4         ATGCTGGTGAAGACAGAGACCCTGGCTGAGTATGTCGTGCGCACTTTTGCCCTGGAGCGG
                    ************************************************************

HsCD00297779        AGAGGCTACTCTGCCCGGCACGAGGTCCGCCAGTTCCACTTCACAGCGTGGCCAGAGCAT
NM_133177.3         AGAGGCTACTCTGCCCGGCACGAGGTCCGCCAGTTCCACTTCACAGCGTGGCCAGAGCAT
NM_001195001.1      AGAGGCTACTCTGCCCGGCACGAGGTCCGCCAGTTCCACTTCACAGCGTGGCCAGAGCAT
NM_133178.3         AGAGGCTACTCTGCCCGGCACGAGGTCCGCCAGTTCCACTTCACAGCGTGGCCAGAGCAT
NM_005704.4         AGAGGCTACTCTGCCCGGCACGAGGTCCGCCAGTTCCACTTCACAGCGTGGCCAGAGCAT
                    ************************************************************

HsCD00297779        GGCGTCCCCTACCATGCCACGGGGCTGCTGGCTTTCATCCGGCGCGTGAAGGCCTCCACC
NM_133177.3         GGCGTCCCCTACCATGCCACGGGGCTGCTGGCTTTCATCCGGCGCGTGAAGGCCTCCACC
NM_001195001.1      GGCGTCCCCTACCATGCCACGGGGCTGCTGGCTTTCATCCGGCGCGTGAAGGCCTCCACC
NM_133178.3         GGCGTCCCCTACCATGCCACGGGGCTGCTGGCTTTCATCCGGCGCGTGAAGGCCTCCACC
NM_005704.4         GGCGTCCCCTACCATGCCACGGGGCTGCTGGCTTTCATCCGGCGCGTGAAGGCCTCCACC
                    ************************************************************

HsCD00297779        CCACCTGATGCCGGGCCCATTGTCATCCACTGCAGCGCGGGCACCGGCCGCACAGGTTGC
NM_133177.3         CCACCTGATGCCGGGCCCATTGTCATCCACTGCAGCGCGGGCACCGGCCGCACAGGTTGC
NM_001195001.1      CCACCTGATGCCGGGCCCATTGTCATCCACTGCAGCGCGGGCACCGGCCGCACAGGTTGC
NM_133178.3         CCACCTGATGCCGGGCCCATTGTCATCCACTGCAGCGCGGGCACCGGCCGCACAGGTTGC
NM_005704.4         CCACCTGATGCCGGGCCCATTGTCATCCACTGCAGCGCGGGCACCGGCCGCACAGGTTGC
                    ************************************************************

HsCD00297779        TATATCGTCCTGGATGTGATGCTGGACATGGCAGAGTGTGAGGGCGTCGTGGACATTTAC
NM_133177.3         TATATCGTCCTGGATGTGATGCTGGACATGGCAGAGTGTGAGGGCGTCGTGGACATTTAC
NM_001195001.1      TATATCGTCCTGGATGTGATGCTGGACATGGCAGAGTGTGAGGGCGTCGTGGACATTTAC
NM_133178.3         TATATCGTCCTGGATGTGATGCTGGACATGGCAGAGTGTGAGGGCGTCGTGGACATTTAC
NM_005704.4         TATATCGTCCTGGATGTGATGCTGGACATGGCAGAGTGTGAGGGCGTCGTGGACATTTAC
                    ************************************************************

HsCD00297779        AACTGTGTGAAGACTCTCTGCTCCCGGCGTGTCAACATGATCCAGACTGAGGAGCAGTAC
NM_133177.3         AACTGTGTGAAGACTCTCTGCTCCCGGCGTGTCAACATGATCCAGACTGAGGAGCAGTAC
NM_001195001.1      AACTGTGTGAAGACTCTCTGCTCCCGGCGTGTCAACATGATCCAGACTGAGGAGCAGTAC
NM_133178.3         AACTGTGTGAAGACTCTCTGCTCCCGGCGTGTCAACATGATCCAGACTGAGGAGCAGTAC
NM_005704.4         AACTGTGTGAAGACTCTCTGCTCCCGGCGTGTCAACATGATCCAGACTGAGGAGCAGTAC
                    ************************************************************

HsCD00297779        ATCTTCATTCATGATGCAATCCTGGAGGCCTGCCTGTGTGGGGAGACCACCATCCCTGTC
NM_133177.3         ATCTTCATTCATGATGCAATCCTGGAGGCCTGCCTGTGTGGGGAGACCACCATCCCTGTC
NM_001195001.1      ATCTTCATTCATGATGCAATCCTGGAGGCCTGCCTGTGTGGGGAGACCACCATCCCTGTC
NM_133178.3         ATCTTCATTCATGATGCAATCCTGGAGGCCTGCCTGTGTGGGGAGACCACCATCCCTGTC
NM_005704.4         ATCTTCATTCATGATGCAATCCTGGAGGCCTGCCTGTGTGGGGAGACCACCATCCCTGTC
                    ************************************************************

HsCD00297779        AGTGAG------------------------------------------------------
NM_133177.3         AGTGAGTTCAAGGCCACCTACAAGGAGATGATCCGCATTGATCCTCAGAGTAATTCCTCC
NM_001195001.1      AGTGAGTTCAAGGCCACCTACAAGGAGATGATCCGCATTGATCCTCAGAGTAATTCCTCC
NM_133178.3         AGTGAGTTCAAGGCCACCTACAAGGAGATGATCCGCATTGATCCTCAGAGTAATTCCTCC
NM_005704.4         AGTGAGTTCAAGGCCACCTACAAGGAGATGATCCGCATTGATCCTCAGAGTAATTCCTCC
                    ******                                                      

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CAGCTGCGGGAAGAGTTCCAGACGCTGAACTCGGTCACCCCGCCGCTGGACGTGGAGGAG
NM_001195001.1      CAGCTGCGGGAAGAGTTCCAGACGCTGAACTCGGTCACCCCGCCGCTGGACGTGGAGGAG
NM_133178.3         CAGCTGCGGGAAGAGTTCCAGACGCTGAACTCGGTCACCCCGCCGCTGGACGTGGAGGAG
NM_005704.4         CAGCTGCGGGAAGAGTTCCAGACGCTGAACTCGGTCACCCCGCCGCTGGACGTGGAGGAG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         TGCAGCATCGCCCTGTTGCCCCGGAACCGCGACAAGAACCGCAGCATGGACGTCCTGCCG
NM_001195001.1      TGCAGCATCGCCCTGTTGCCCCGGAACCGCGACAAGAACCGCAGCATGGACGTCCTGCCG
NM_133178.3         TGCAGCATCGCCCTGTTGCCCCGGAACCGCGACAAGAACCGCAGCATGGACGTCCTGCCG
NM_005704.4         TGCAGCATCGCCCTGTTGCCCCGGAACCGCGACAAGAACCGCAGCATGGACGTCCTGCCG
                                                                                

HsCD00297779        --------------------------------TTCGAAGGGCATCATCACCATCACCACT
NM_133177.3         CCCGACCGCTGCCTGCCCTTCCTCATCTCCACTGATGGGGACTCCAACAACTACATTAAT
NM_001195001.1      CCCGACCGCTGCCTGCCCTTCCTCATCTCCACTGATGGGGACTCCAACAACTACATTAAT
NM_133178.3         CCCGACCGCTGCCTGCCCTTCCTCATCTCCACTGATGGGGACTCCAACAACTACATTAAT
NM_005704.4         CCCGACCGCTGCCTGCCCTTCCTCATCTCCACTGATGGGGACTCCAACAACTACATTAAT
                                                    * . ..**.*: **:**.*::**  *.*

HsCD00297779        GATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCAC---------
NM_133177.3         GCAGCCCTGACTGACAGCTACACACGGAGTGCGGCCTTCATCGTGACCCTGCACCCGCTG
NM_001195001.1      GCAGCCCTGACTGACAGCTACACACGGAGTGCGGCCTTCATCGTGACCCTGCACCCGCTG
NM_133178.3         GCAGCCCTGACTGACAGCTACACACGGAGTGCGGCCTTCATCGTGACCCTGCACCCGCTG
NM_005704.4         GCAGCCCTGACTGACAGCTACACACGGAGTGCGGCCTTCATCGTGACCCTGCACCCGCTG
                    *.: * .: :* ..*: * :*.....*. *******  ..***:*..**:          

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CAGAGCACCACGCCCGACTTCTGGCGGCTGGTCTACGATTACGGGTGCACCTCCATCGTC
NM_001195001.1      CAGAGCACCACGCCCGACTTCTGGCGGCTGGTCTACGATTACGGGTGCACCTCCATCGTC
NM_133178.3         CAGAGCACCACGCCCGACTTCTGGCGGCTGGTCTACGATTACGGGTGCACCTCCATCGTC
NM_005704.4         CAGAGCACCACGCCCGACTTCTGGCGGCTGGTCTACGATTACGGGTGCACCTCCATCGTC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         ATGCTCAACCAGCTGAACCAGTCCAACTCCGCCTGGCCCTGCCTGCAGTACTGGCCAGAG
NM_001195001.1      ATGCTCAACCAGCTGAACCAGTCCAACTCCGCCTGGCCCTGCCTGCAGTACTGGCCAGAG
NM_133178.3         ATGCTCAACCAGCTGAACCAGTCCAACTCCGCCTGGCCCTGCCTGCAGTACTGGCCAGAG
NM_005704.4         ATGCTCAACCAGCTGAACCAGTCCAACTCCGCCTGGCCCTGCCTGCAGTACTGGCCAGAG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CCAGGCCGGCAGCAATATGGCCTCATGGAGGTGGAGTTTATGTCGGGCACAGCTGATGAA
NM_001195001.1      CCAGGCCGGCAGCAATATGGCCTCATGGAGGTGGAGTTTATGTCGGGCACAGCTGATGAA
NM_133178.3         CCAGGCCGGCAGCAATATGGCCTCATGGAGGTGGAGTTTATGTCGGGCACAGCTGATGAA
NM_005704.4         CCAGGCCGGCAGCAATATGGCCTCATGGAGGTGGAGTTTATGTCGGGCACAGCTGATGAA
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         GACTTAGTGGCTCGAGTCTTCCGGGTGCAGAACATCTCTCG------GGAGGGGCACCTG
NM_001195001.1      GACTTAGTGGCTCGAGTCTTCCGGGTGCAGAACATCTCTCGGTTGCAGGAGGGGCACCTG
NM_133178.3         GACTTAGTGGCTCGAGTCTTCCGGGTGCAGAACATCTCTCGGTTGCAGGAGGGGCACCTG
NM_005704.4         GACTTAGTGGCTCGAGTCTTCCGGGTGCAGAACATCTCTCGGTTGCAGGAGGGGCACCTG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CTGGTGCGGCACTTCCAGTTCCTGCGCTGGTCTGCATACCGGGACACACCTGACTCCAAG
NM_001195001.1      CTGGTGCGGCACTTCCAGTTCCTGCGCTGGTCTGCATACCGGGACACACCTGACTCCAAG
NM_133178.3         CTGGTGCGGCACTTCCAGTTCCTGCGCTGGTCTGCATACCGGGACACACCTGACTCCAAG
NM_005704.4         CTGGTGCGGCACTTCCAGTTCCTGCGCTGGTCTGCATACCGGGACACACCTGACTCCAAG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         AAGGCCTTCTTGCACCTGCTGGCTGAGGTGGACAAGTGGCAGGCCGAGAGTGGGGATGGG
NM_001195001.1      AAGGCCTTCTTGCACCTGCTGGCTGAGGTGGACAAGTGGCAGGCCGAGAGTGGGGATGGG
NM_133178.3         AAGGCCTTCTTGCACCTGCTGGCTGAGGTGGACAAGTGGCAGGCCGAGAGTGGGGATGGG
NM_005704.4         AAGGCCTTCTTGCACCTGCTGGCTGAGGTGGACAAGTGGCAGGCCGAGAGTGGGGATGGG
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CGCACCATCGTGCACTGCCTAAACGGGGGAGGACGCAGCGGCACCTTCTGCGCCTGCGCC
NM_001195001.1      CGCACCATCGTGCACTGCCTAAACGGGGGAGGACGCAGCGGCACCTTCTGCGCCTGCGCC
NM_133178.3         CGCACCATCGTGCACTGCCTAAACGGGGGAGGACGCAGCGGCACCTTCTGCGCCTGCGCC
NM_005704.4         CGCACCATCGTGCACTGCCTAAACGGGGGAGGACGCAGCGGCACCTTCTGCGCCTGCGCC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         ACGGTCCTGGAGATGATCCGCTGCCACAACTTGGTGGACGTTTTCTTTGCTGCCAAAACC
NM_001195001.1      ACGGTCCTGGAGATGATCCGCTGCCACAACTTGGTGGACGTTTTCTTTGCTGCCAAAACC
NM_133178.3         ACGGTCCTGGAGATGATCCGCTGCCACAACTTGGTGGACGTTTTCTTTGCTGCCAAAACC
NM_005704.4         ACGGTCCTGGAGATGATCCGCTGCCACAACTTGGTGGACGTTTTCTTTGCTGCCAAAACC
                                                                                

HsCD00297779        ------------------------------------------------------------
NM_133177.3         CTCCGGAACTACAAACCCAACATGGTGGAGACCATGGATCAGTACCACTTTTGCTACGAT
NM_001195001.1      CTCCGGAACTACAAACCCAACATGGTGGAGACCATGGATCAGTACCACTTTTGCTACGAT
NM_133178.3         CTCCGGAACTACAAACCCAACATGGTGGAGACCATGGATCAGTACCACTTTTGCTACGAT
NM_005704.4         CTCCGGAACTACAAACCCAACATGGTGGAGACCATGGATCAGTACCACTTTTGCTACGAT
                                                                                

HsCD00297779        ---------------------------------------
NM_133177.3         GTGGCCCTGGAGTACTTGGAGGGGCTGGAGTCAAGATAG
NM_001195001.1      GTGGCCCTGGAGTACTTGGAGGGGCTGGAGTCAAGATAG
NM_133178.3         GTGGCCCTGGAGTACTTGGAGGGGCTGGAGTCAAGATAG
NM_005704.4         GTGGCCCTGGAGTACTTGGAGGGGCTGGAGTCAAGATAG
                                                           

Clone

Cloning Information : 495353
HIP Master Clone ID : 409033
Original Clone ID : 8709a13BCt10p1

Experimental

TargetTrack - Experimental data : NYSGXRC-8709a

Organism


TAX_ID : 9606
Species Specific ID: None

Genome

Chromosome : 1
Map Location : 1p35.3
Ensembl : ENSG00000060656

Reagents

Labome : PTPRU-antibody