DNASU Plasmid Repository • 480.965.5697 | Email

RFK (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RFK
Gene Name:  riboflavin kinase
Sequence             
Original Clone ID: FLH231944.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00299599

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 489nts         Open reading frame : 1 to 489
Reference Sequence Alignment

ATGCCCCGAGCGGACTGCATTATGAGGCACCTGCCTTACTTCTGCCGGGGTCAAGTGGTG
CGGGGCTTCGGCCGCGGCTCCAAGCAGCTGGGCATCCCCACAGCTAATTTTCCTGAGCAA
GTGGTAGATAATCTTCCAGCTGATATATCCACTGGTATTTACTATGGTTGGGCCAGTGTT
GGAAGTGGAGATGTCCATAAGATGGTGGTGAGCATAGGATGGAACCCATATTACAAGAAT
ACGAAGAAGTCTATGGAAACACATATCATGCATACCTTCAAAGAGGACTTCTATGGGGAA
ATCCTCAATGTGGCCATTGTTGGCTACCTGAGACCAGAAAAGAACTTTGATTCTTTAGAG
TCACTTATTTCAGCAATTCAAGGTGATATTGAAGAAGCTAAGAAACGACTAGAGTTACCA
GAACATTTGAAAATCAAAGAAGACAATTTCTTCCAGGTTTCTAAAAGCAAAATAATGAAT
GGCCACTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 647
Start on reference sequence 159
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RFK
Symbol Nomenclature : RFK
SYNONYM : RIFK
Designation : 0610038L10Rik|ATP:riboflavin 5'-phosphotransferase|flavokinase
Full Nomenclature : riboflavin kinase
GENEID : 55312
Locus Tag : RP11-422N19.2
HGNC : 30324
MIM : 613010
Vega : OTTHUMG00000020040
Target GenBank: BC015473

 

Reference Sequence Alignment

  

HsCD00299599      ATGCCCCGAGCGGACTGCATTATGAGGCACCTGCCTTACTTCTGCCGGGGTCAAGTGGTG
NM_018339.5       ---------------------ATGAGGCACCTGCCTTACTTCTGCCGGGGTCAAGTGGTG
                                       ***************************************

HsCD00299599      CGGGGCTTCGGCCGCGGCTCCAAGCAGCTGGGCATCCCCACAGCTAATTTTCCTGAGCAA
NM_018339.5       CGGGGCTTCGGCCGCGGCTCCAAGCAGCTGGGCATCCCCACAGCTAATTTTCCTGAGCAA
                  ************************************************************

HsCD00299599      GTGGTAGATAATCTTCCAGCTGATATATCCACTGGTATTTACTATGGTTGGGCCAGTGTT
NM_018339.5       GTGGTAGATAATCTTCCAGCTGATATATCCACTGGTATTTACTATGGTTGGGCCAGTGTT
                  ************************************************************

HsCD00299599      GGAAGTGGAGATGTCCATAAGATGGTGGTGAGCATAGGATGGAACCCATATTACAAGAAT
NM_018339.5       GGAAGTGGAGATGTCCATAAGATGGTGGTGAGCATAGGATGGAACCCATATTACAAGAAT
                  ************************************************************

HsCD00299599      ACGAAGAAGTCTATGGAAACACATATCATGCATACCTTCAAAGAGGACTTCTATGGGGAA
NM_018339.5       ACGAAGAAGTCTATGGAAACACATATCATGCATACCTTCAAAGAGGACTTCTATGGGGAA
                  ************************************************************

HsCD00299599      ATCCTCAATGTGGCCATTGTTGGCTACCTGAGACCAGAAAAGAACTTTGATTCTTTAGAG
NM_018339.5       ATCCTCAATGTGGCCATTGTTGGCTACCTGAGACCAGAAAAGAACTTTGATTCTTTAGAG
                  ************************************************************

HsCD00299599      TCACTTATTTCAGCAATTCAAGGTGATATTGAAGAAGCTAAGAAACGACTAGAGTTACCA
NM_018339.5       TCACTTATTTCAGCAATTCAAGGTGATATTGAAGAAGCTAAGAAACGACTAGAGTTACCA
                  ************************************************************

HsCD00299599      GAACATTTGAAAATCAAAGAAGACAATTTCTTCCAGGTTTCTAAAAGCAAAATAATGAAT
NM_018339.5       GAACATTTGAAAATCAAAGAAGACAATTTCTTCCAGGTTTCTAAAAGCAAAATAATGAAT
                  ************************************************************

HsCD00299599      GGCCACTTG
NM_018339.5       GGCCACTGA
                  ******* .

Pathways

Panther : Flavin biosynthesis
Reactome : Defective AMN causes hereditary megaloblastic anemia 1
Reactome : Defective BTD causes biotidinase deficiency
Reactome : Defective CD320 causes methylmalonic aciduria
Reactome : Defective CUBN causes hereditary megaloblastic anemia 1
Reactome : Defective GIF causes intrinsic factor deficiency
Reactome : Defective HLCS causes multiple carboxylase deficiency
Reactome : Defective LMBRD1 causes methylmalonic aciduria and homocystinuria type cblF
Reactome : Defective MMAA causes methylmalonic aciduria type cblA
Reactome : Defective MMAB causes methylmalonic aciduria type cblB
Reactome : Defective MMACHC causes methylmalonic aciduria and homocystinuria type cblC
Reactome : Defective MMADHC causes methylmalonic aciduria and homocystinuria type cblD
Reactome : Defective MTR causes methylmalonic aciduria and homocystinuria type cblG
Reactome : Defective MTRR causes methylmalonic aciduria and homocystinuria type cblE
Reactome : Defective MUT causes methylmalonic aciduria mut type
Reactome : Defective TCN2 causes hereditary megaloblastic anemia
Reactome : Defects in biotin (Btn) metabolism
Reactome : Defects in cobalamin (B12) metabolism
Reactome : Defects in vitamin and cofactor metabolism
Reactome : Disease
Reactome : Metabolism
Reactome : Metabolism of vitamins and cofactors
Reactome : Metabolism of water-soluble vitamins and cofactors
Reactome : Vitamin B2 (riboflavin) metabolism
WikiPathway : Folate Metabolism
WikiPathway : Selenium Pathway
WikiPathway : TNF alpha Signaling Pathway

Protein

SMART domain : Flavokinase : Riboflavin kinase
UniProt : Q969G6
UniProt : B2RDZ2
HPRD : 17969

Clone

Cloning Information : 231944
HIP Master Clone ID : 87192
Original Clone ID : FLH231944.01L

Organism


TAX_ID : 9606
Species Specific ID: 55312

Genome

Chromosome : 9
Map Location : 9q21.13
Ensembl : ENSG00000135002

Reagents

Labome : RFK-antibody