DNASU Plasmid Repository • 480.965.5697 | Email

MAPK12 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAPK12
Gene Name:  mitogen-activated protein kinase 12
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH147930.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000301

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1104nts         Open reading frame : 1 to 1104
Reference Sequence Alignment

ATGAGCTCTCCGCCGCCCGCCCGCAGTGGCTTTTACCGCCAGGAGGTGACCAAGACGGCC
TGGGAGGTGCGCGCCGTGTACCGGGACCTGCAGCCCGTGGGCTCGGGCGCCTACGGCGCG
GTGTGCTCGGCCGTGGACGGCCGCACCGGCGCTAAGGTGGCCATCAAGAAGCTGTATCGG
CCCTTCCAGTCCGAGCTGTTCGCCAAGCGCGCCTACCGCGAGCTGCGCCTGCTCAAGCAC
ATGCGCCACGAGAACGTGATCGGGCTGCTGGACGTATTCACTCCTGATGAGACCCTGGAT
GACTTCACGGACTTTTACCTGGTGATGCCGTTCATGGGCACCGACCTGGGCAAGCTCATG
AAACATGAGAAGCTAGGCGAGGACCGGATCCAGTTCCTCGTGTACCAGATGCTGAAGGGG
CTGAGGTATATCCACGCTGCCGGCATCATCCACAGAGACCTGAAGCCCGGCAACCTGGCT
GTGAACGAAGACTGTGAGCTGAAGATCCTGGACTTCGGCCTGGCCAGGCAGGCAGACAGT
GAGATGACTGGGTACGTGGTGACCCGGTGGTACCGGGCTCCCGAGGTCATCTTGAATTGG
ATGCGCTACACGCAGACGGTGGACATCTGGTCCGTGGGCTGCATCATGGCGGAGATGATC
ACAGGCAAGACGCTGTTCAAGGGCAGCGACCACCTGGACCAGCTGAAGGAGATCATGAAG
GTGACGGGGACGCCTCCGGCTGAGTTTGTGCAGCGGCTGCAGAGCGATGAGGCCAAGAAC
TACATGAAGGGCCTCCCCGAATTGGAGAAGAAGGATTTTGCCTCTATCCTGACCAATGCA
AGCCCTCTGGCTGTGAACCTCCTGGAGAAGATGCTGGTGCTGGACGCGGAGCAGCGGGTG
ACGGCAGGCGAGGCGCTGGCCCATCCCTACTTCGAGTCCCTGCACGACACGGAAGATGAG
CCCCAGGTCCAGAAGTATGATGACTCCTTTGACGACGTTGACCGCACACTGGATGAATGG
AAGCGTGTTACTTACAAAGAGGTGCTCAGCTTCAAGCCTCCCCGGCAGCTGGGGGCCAGG
GTCTCCAAGGAGACACCTCTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1413
Start on reference sequence 310
Mutations:
None
Discrepancy:
a781t,N261Y; g1095a
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAPK12
Symbol Nomenclature : MAPK12
SYNONYM : ERK3; ERK6; P38GAMMA; PRKM12; SAPK-3; SAPK3
Designation : ERK-6|MAP kinase 12|MAP kinase p38 gamma|MAPK 12|extracellular signal-regulated kinase 6|mitogen-activated protein kinase 3|mitogen-activated protein kinase p38 gamma|stress-activated protein kinase 3
Full Nomenclature : mitogen-activated protein kinase 12
GENEID : 6300
GI : 61365357
GenBank Accession : AY890754
HGNC : 6874
MIM : 602399
Vega : OTTHUMG00000030145
Target GenBank: NM_002969

 

Reference Sequence Alignment

  

HsCD00000301      ATGAGCTCTCCGCCGCCCGCCCGCAGTGGCTTTTACCGCCAGGAGGTGACCAAGACGGCC
NM_002969.3       ATGAGCTCTCCGCCGCCCGCCCGCAGTGGCTTTTACCGCCAGGAGGTGACCAAGACGGCC
                  ************************************************************

HsCD00000301      TGGGAGGTGCGCGCCGTGTACCGGGACCTGCAGCCCGTGGGCTCGGGCGCCTACGGCGCG
NM_002969.3       TGGGAGGTGCGCGCCGTGTACCGGGACCTGCAGCCCGTGGGCTCGGGCGCCTACGGCGCG
                  ************************************************************

HsCD00000301      GTGTGCTCGGCCGTGGACGGCCGCACCGGCGCTAAGGTGGCCATCAAGAAGCTGTATCGG
NM_002969.3       GTGTGCTCGGCCGTGGACGGCCGCACCGGCGCTAAGGTGGCCATCAAGAAGCTGTATCGG
                  ************************************************************

HsCD00000301      CCCTTCCAGTCCGAGCTGTTCGCCAAGCGCGCCTACCGCGAGCTGCGCCTGCTCAAGCAC
NM_002969.3       CCCTTCCAGTCCGAGCTGTTCGCCAAGCGCGCCTACCGCGAGCTGCGCCTGCTCAAGCAC
                  ************************************************************

HsCD00000301      ATGCGCCACGAGAACGTGATCGGGCTGCTGGACGTATTCACTCCTGATGAGACCCTGGAT
NM_002969.3       ATGCGCCACGAGAACGTGATCGGGCTGCTGGACGTATTCACTCCTGATGAGACCCTGGAT
                  ************************************************************

HsCD00000301      GACTTCACGGACTTTTACCTGGTGATGCCGTTCATGGGCACCGACCTGGGCAAGCTCATG
NM_002969.3       GACTTCACGGACTTTTACCTGGTGATGCCGTTCATGGGCACCGACCTGGGCAAGCTCATG
                  ************************************************************

HsCD00000301      AAACATGAGAAGCTAGGCGAGGACCGGATCCAGTTCCTCGTGTACCAGATGCTGAAGGGG
NM_002969.3       AAACATGAGAAGCTAGGCGAGGACCGGATCCAGTTCCTCGTGTACCAGATGCTGAAGGGG
                  ************************************************************

HsCD00000301      CTGAGGTATATCCACGCTGCCGGCATCATCCACAGAGACCTGAAGCCCGGCAACCTGGCT
NM_002969.3       CTGAGGTATATCCACGCTGCCGGCATCATCCACAGAGACCTGAAGCCCGGCAACCTGGCT
                  ************************************************************

HsCD00000301      GTGAACGAAGACTGTGAGCTGAAGATCCTGGACTTCGGCCTGGCCAGGCAGGCAGACAGT
NM_002969.3       GTGAACGAAGACTGTGAGCTGAAGATCCTGGACTTCGGCCTGGCCAGGCAGGCAGACAGT
                  ************************************************************

HsCD00000301      GAGATGACTGGGTACGTGGTGACCCGGTGGTACCGGGCTCCCGAGGTCATCTTGAATTGG
NM_002969.3       GAGATGACTGGGTACGTGGTGACCCGGTGGTACCGGGCTCCCGAGGTCATCTTGAATTGG
                  ************************************************************

HsCD00000301      ATGCGCTACACGCAGACGGTGGACATCTGGTCCGTGGGCTGCATCATGGCGGAGATGATC
NM_002969.3       ATGCGCTACACGCAGACGGTGGACATCTGGTCTGTGGGCTGCATCATGGCGGAGATGATC
                  ******************************** ***************************

HsCD00000301      ACAGGCAAGACGCTGTTCAAGGGCAGCGACCACCTGGACCAGCTGAAGGAGATCATGAAG
NM_002969.3       ACAGGCAAGACGCTGTTCAAGGGCAGCGACCACCTGGACCAGCTGAAGGAGATCATGAAG
                  ************************************************************

HsCD00000301      GTGACGGGGACGCCTCCGGCTGAGTTTGTGCAGCGGCTGCAGAGCGATGAGGCCAAGAAC
NM_002969.3       GTGACGGGGACGCCTCCGGCTGAGTTTGTGCAGCGGCTGCAGAGCGATGAGGCCAAGAAC
                  ************************************************************

HsCD00000301      TACATGAAGGGCCTCCCCGAATTGGAGAAGAAGGATTTTGCCTCTATCCTGACCAATGCA
NM_002969.3       TACATGAAGGGCCTCCCCGAATTGGAGAAGAAGGATTTTGCCTCTATCCTGACCAATGCA
                  ************************************************************

HsCD00000301      AGCCCTCTGGCTGTGAACCTCCTGGAGAAGATGCTGGTGCTGGACGCGGAGCAGCGGGTG
NM_002969.3       AGCCCTCTGGCTGTGAACCTCCTGGAGAAGATGCTGGTGCTGGACGCGGAGCAGCGGGTG
                  ************************************************************

HsCD00000301      ACGGCAGGCGAGGCGCTGGCCCATCCCTACTTCGAGTCCCTGCACGACACGGAAGATGAG
NM_002969.3       ACGGCAGGCGAGGCGCTGGCCCATCCCTACTTCGAGTCCCTGCACGACACGGAAGATGAG
                  ************************************************************

HsCD00000301      CCCCAGGTCCAGAAGTATGATGACTCCTTTGACGACGTTGACCGCACACTGGATGAATGG
NM_002969.3       CCCCAGGTCCAGAAGTATGATGACTCCTTTGACGACGTTGACCGCACACTGGATGAATGG
                  ************************************************************

HsCD00000301      AAGCGTGTTACTTACAAAGAGGTGCTCAGCTTCAAGCCTCCCCGGCAGCTGGGGGCCAGG
NM_002969.3       AAGCGTGTTACTTACAAAGAGGTGCTCAGCTTCAAGCCTCCCCGGCAGCTGGGGGCCAGG
                  ************************************************************

HsCD00000301      GTCTCCAAGGAGACACCTCTGTTG
NM_002969.3       GTCTCCAAGGAGACGCCTCTGTGA
                  **************.******* .

Pathways

NCI : RhoA signaling pathway
NCI : Signaling mediated by p38-gamma and p38-delta
Panther : Alzheimer disease-amyloid secretase pathway
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Interferon-gamma signaling pathway
Panther : Oxidative stress response
Panther : Parkinson disease
Panther : Ras Pathway
Panther : TGF-beta signaling pathway
Panther : p38 MAPK pathway
Panther : p53 pathway feedback loops 2
Reactome : Activation of PPARGC1A (PGC-1alpha) by phosphorylation
Reactome : CDO in myogenesis
Reactome : Cell-Cell communication
Reactome : DSCAM interactions
Reactome : Developmental Biology
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Mitochondrial biogenesis
Reactome : Myogenesis
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Organelle biogenesis and maintenance
Reactome : Signal Transduction
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : p38MAPK events
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Lymphocyte TarBase
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : Muscle cell TarBase
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Signal Transduction of S1P Receptor
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 147930
HIP Master Clone ID : 124249
Original Clone ID : FLH147930.01L

Organism


TAX_ID : 9606
Species Specific ID: 6300

Genome

Chromosome : 22
Map Location : 22q13.33
Ensembl : ENSG00000188130

Reagents

Labome : MAPK12-antibody