DNASU Plasmid Repository • 480.965.5697 | Email

PCK1 (Homo sapiens) in pLDNT7_nFLAG (Flag-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PCK1
Gene Name:  phosphoenolpyruvate carboxykinase 1 (soluble)
Sequence             
Original Clone ID: FLH231893.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLDNT7_nFLAG               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00301003

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1869nts         Open reading frame : 1 to 1869
Reference Sequence Alignment

ATGCCTCCTCAGCTGCAAAACGGCCTGAACCTCTCGGCCAAAGTTGTCCAGGGAAGCCTG
GACAGCCTGCCCCAGGCAGTGAGGGAGTTTCTCGAGAATAACGCTGAGCTGTGTCAGCCT
GATCACATCCACATCTGTGACGGCTCTGAGGAGGAGAATGGGCGGCTTCTGGGCCAGATG
GAGGAAGAGGGCATCCTCAGGCGGCTGAAGAAGTATGACAACTGCTGGTTGGCTCTCACT
GACCCCAGGGATGTGGCCAGGATCGAAAGCAAGACGGTTATCGTCACCCAAGAGCAAAGA
GACACAGTGCCCATCCCCAAAACAGGCCTCAGCCAGCTCGGTCGCTGGATGTCAGAGGAG
GATTTTGAGAAAGCGTTCAATGCCAGGTTCCCAGGGTGCATGAAAGGTCGCACCATGTAC
GTCATCCCATTCAGCATGGGGCCGCTGGGCTCACCTCTGTCGAAGATCGGCATCGAGCTG
ACGGATTCGCCCTACGTGGTGGCCAGCATGCGGATCATGACGCGGATGGGCACGCCCGTC
CTGGAAGCACTGGGCGATGGGGAGTTTGTCAAATGCCTCCATTCTGTGGGGTGCCCTCTG
CCTTTACAAAAGCCTTTGGTCAACAACTGGCCCTGCAACCCGGAGCTGACGCTCATCGCC
CACCTGCCTGACCGCAGAGAGATCATCTCCTTTGGCAGTGGGTACGGCGGGAACTCGCTG
CTCGGGAAGAAGTGCTTTGCTCTCAGGATGGCCAGCCGGCTGGCCAAGGAGGAAGGGTGG
CTGGCAGAGCACATGCTGGTTCTGGGTATAACCAACCCTGAGGGTGAGAAGAAGTACCTG
GCGGCCGCATTTCCCAGCGCCTGCGGGAAGACCAACCTGGCCATGATGAACCCCAGCCTC
CCCGGGTGGAAGGTTGAGTGCGTCGGGGATGACATTGCCTGGATGAAGTTTGACGCACAA
GGTCATTTAAGGGCCATCAACCCAGAAAATGGCTTTTTCGGTGTCGCTCCTGGGACTTCA
GTGAAGACCAACCCCAATGCCATCAAGACCATCCAGAAGAACACAATCTTTACCAATGTG
GCCGAGACCAGCGACGGGGGCGTTTACTGGGAAGGCATTGATGAGCCGCTAGCTTCAGGT
GTCACCATCACGTCCTGGAAGAATAAGGAGTGGAGCTCAGAGGATGGGGAACCTTGTGCC
CACCCCAACTCGAGGTTCTGCACCCCTGCCAGCCAGTGCCCCATCATTGATGCTGCCTGG
GAGTCTCCGGAAGGTGTTCCCATTGAAGGCATTATCTTTGGAGGCCGTAGACCTGCTGGT
GTCCCTCTAGTCTATGAAGCTCTCAGCTGGCAACATGGAGTCTTTGTGGGGGCGGCCATG
AGATCAGAGGCCACAGCGGCTGCAGAACATAAAGGCAAAATCATCATGCATGACCCCTTT
GCCATGCGGCCCTTCTTTGGCTACAACTTCGGCAAATACCTGGCCCACTGGCTTAGCATG
GCCCAGCACCCAGCAGCCAAACTGCCCAAGATCTTCCATGTCAACTGGTTCCGGAAGGAC
AAGGAAGGCAAATTCCTCTGGCCAGGCTTTGGAGAGAACTCCAGGGTGCTGGAGTGGATG
TTCAACCGGATCGATGGAAAAGCCAGCACCAAGCTCACGCCCATAGGCTACATCCCCAAG
GAGGATGCCCTGAACCTGAAAGGCCTGGGGCACATCAACATGATGGAGCTTTTCAGCATC
TCCAAGGAATTCTGGGAGAAGGAGGTGGAAGACATCGAGAAGTATCTGGAGGATCAAGTC
AATGCCGACCTCCCCTGTGAAATCGAGAGAGAGATCCTTGCCTTGAAGCAAAGAATAAGC
CAGATGTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 2007
Start on reference sequence 139
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLDNT7_nFLAG

pLDNT7_nFLAG in advanced viewed

Synonyms: pLDNT7-Flag
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Vector for in vitro translation with mammalian extracts, adds N-terminal Flag epitope tag; amp resistance; recombinational cloning
Comments: None
Size (bp): 4557
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), in vitro transcription, loxP, ssDNA production, with tag/fusion/marker
Author Name: Daniel Schiwek
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ori ColE1 origin of replication 1842 2524
promoter T7 T7 promoter 4462 4479
recombination site LoxP LoxP site for recombinational cloning 657 690
selectable marker AmpR ampicillin resistance gene 2622 3281
ssDNA origin f1 ori f1 origin for ssDNA production 3928 4368
tag Flag 3xFlag epitope tag ORF and LoxP region 585 650
trxn termination sequence T7 term T7 terminator sequence 1614 1660

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PCK1
Symbol Nomenclature : PCK1
SYNONYM : PEPCK-C; PEPCK1; PEPCKC
Designation : PEP carboxykinase|phosphoenolpyruvate carboxykinase, cytosolic|phosphoenolpyruvate carboxykinase, cytosolic [GTP]|phosphoenolpyruvate carboxylase|phosphopyruvate carboxylase
Full Nomenclature : phosphoenolpyruvate carboxykinase 1 (soluble)
GENEID : 5105
HGNC : 8724
MIM : 614168
Vega : OTTHUMG00000032825
Target GenBank: BC023978

 

Reference Sequence Alignment

  

HsCD00301003      ATGCCTCCTCAGCTGCAAAACGGCCTGAACCTCTCGGCCAAAGTTGTCCAGGGAAGCCTG
NM_002591.3       ATGCCTCCTCAGCTGCAAAACGGCCTGAACCTCTCGGCCAAAGTTGTCCAGGGAAGCCTG
                  ************************************************************

HsCD00301003      GACAGCCTGCCCCAGGCAGTGAGGGAGTTTCTCGAGAATAACGCTGAGCTGTGTCAGCCT
NM_002591.3       GACAGCCTACCCCAGGCAGTGAGGGAGTTTCTCGAGAATAACGCTGAGCTGTGTCAGCCT
                  ********.***************************************************

HsCD00301003      GATCACATCCACATCTGTGACGGCTCTGAGGAGGAGAATGGGCGGCTTCTGGGCCAGATG
NM_002591.3       GATCACATCCACATCTGTGACGGCTCTGAGGAGGAGAATGGGCGGCTTCTGGGCCAGATG
                  ************************************************************

HsCD00301003      GAGGAAGAGGGCATCCTCAGGCGGCTGAAGAAGTATGACAACTGCTGGTTGGCTCTCACT
NM_002591.3       GAGGAAGAGGGCATCCTCAGGCGGCTGAAGAAGTATGACAACTGCTGGTTGGCTCTCACT
                  ************************************************************

HsCD00301003      GACCCCAGGGATGTGGCCAGGATCGAAAGCAAGACGGTTATCGTCACCCAAGAGCAAAGA
NM_002591.3       GACCCCAGGGATGTGGCCAGGATCGAAAGCAAGACGGTTATCGTCACCCAAGAGCAAAGA
                  ************************************************************

HsCD00301003      GACACAGTGCCCATCCCCAAAACAGGCCTCAGCCAGCTCGGTCGCTGGATGTCAGAGGAG
NM_002591.3       GACACAGTGCCCATCCCCAAAACAGGCCTCAGCCAGCTCGGTCGCTGGATGTCAGAGGAG
                  ************************************************************

HsCD00301003      GATTTTGAGAAAGCGTTCAATGCCAGGTTCCCAGGGTGCATGAAAGGTCGCACCATGTAC
NM_002591.3       GATTTTGAGAAAGCGTTCAATGCCAGGTTCCCAGGGTGCATGAAAGGTCGCACCATGTAC
                  ************************************************************

HsCD00301003      GTCATCCCATTCAGCATGGGGCCGCTGGGCTCACCTCTGTCGAAGATCGGCATCGAGCTG
NM_002591.3       GTCATCCCATTCAGCATGGGGCCGCTGGGCTCGCCTCTGTCAAAGATCGGCATCGAGCTG
                  ********************************.********.******************

HsCD00301003      ACGGATTCGCCCTACGTGGTGGCCAGCATGCGGATCATGACGCGGATGGGCACGCCCGTC
NM_002591.3       ACGGATTCACCCTACGTGGTGGCCAGCATGCGGATCATGACGCGGATGGGCACGCCCGTC
                  ********.***************************************************

HsCD00301003      CTGGAAGCACTGGGCGATGGGGAGTTTGTCAAATGCCTCCATTCTGTGGGGTGCCCTCTG
NM_002591.3       CTGGAAGCAGTGGGCGATGGGGAGTTTGTCAAATGCCTCCATTCTGTGGGGTGCCCTCTG
                  ********* **************************************************

HsCD00301003      CCTTTACAAAAGCCTTTGGTCAACAACTGGCCCTGCAACCCGGAGCTGACGCTCATCGCC
NM_002591.3       CCTTTACAAAAGCCTTTGGTCAACAACTGGCCCTGCAACCCGGAGCTGACGCTCATCGCC
                  ************************************************************

HsCD00301003      CACCTGCCTGACCGCAGAGAGATCATCTCCTTTGGCAGTGGGTACGGCGGGAACTCGCTG
NM_002591.3       CACCTGCCTGACCGCAGAGAGATCATCTCCTTTGGCAGTGGGTACGGCGGGAACTCGCTG
                  ************************************************************

HsCD00301003      CTCGGGAAGAAGTGCTTTGCTCTCAGGATGGCCAGCCGGCTGGCCAAGGAGGAAGGGTGG
NM_002591.3       CTCGGGAAGAAGTGCTTTGCTCTCAGGATGGCCAGCCGGCTGGCCAAGGAGGAAGGGTGG
                  ************************************************************

HsCD00301003      CTGGCAGAGCACATGCTGGTTCTGGGTATAACCAACCCTGAGGGTGAGAAGAAGTACCTG
NM_002591.3       CTGGCAGAGCACATGCTGATTCTGGGTATAACCAACCCTGAGGGTGAGAAGAAGTACCTG
                  ******************.*****************************************

HsCD00301003      GCGGCCGCATTTCCCAGCGCCTGCGGGAAGACCAACCTGGCCATGATGAACCCCAGCCTC
NM_002591.3       GCGGCCGCATTTCCCAGCGCCTGCGGGAAGACCAACCTGGCCATGATGAACCCCAGCCTC
                  ************************************************************

HsCD00301003      CCCGGGTGGAAGGTTGAGTGCGTCGGGGATGACATTGCCTGGATGAAGTTTGACGCACAA
NM_002591.3       CCCGGGTGGAAGGTTGAGTGCGTCGGGGATGACATTGCCTGGATGAAGTTTGACGCACAA
                  ************************************************************

HsCD00301003      GGTCATTTAAGGGCCATCAACCCAGAAAATGGCTTTTTCGGTGTCGCTCCTGGGACTTCA
NM_002591.3       GGTCATTTAAGGGCCATCAACCCAGAAAATGGCTTTTTCGGTGTCGCTCCTGGGACTTCA
                  ************************************************************

HsCD00301003      GTGAAGACCAACCCCAATGCCATCAAGACCATCCAGAAGAACACAATCTTTACCAATGTG
NM_002591.3       GTGAAGACCAACCCCAATGCCATCAAGACCATCCAGAAGAACACAATCTTTACCAATGTG
                  ************************************************************

HsCD00301003      GCCGAGACCAGCGACGGGGGCGTTTACTGGGAAGGCATTGATGAGCCGCTAGCTTCAGGT
NM_002591.3       GCCGAGACCAGCGACGGGGGCGTTTACTGGGAAGGCATTGATGAGCCGCTAGCTTCAGGT
                  ************************************************************

HsCD00301003      GTCACCATCACGTCCTGGAAGAATAAGGAGTGGAGCTCAGAGGATGGGGAACCTTGTGCC
NM_002591.3       GTCACCATCACGTCCTGGAAGAATAAGGAGTGGAGCTCAGAGGATGGGGAACCTTGTGCC
                  ************************************************************

HsCD00301003      CACCCCAACTCGAGGTTCTGCACCCCTGCCAGCCAGTGCCCCATCATTGATGCTGCCTGG
NM_002591.3       CACCCCAACTCGAGGTTCTGCACCCCTGCCAGCCAGTGCCCCATCATTGATGCTGCCTGG
                  ************************************************************

HsCD00301003      GAGTCTCCGGAAGGTGTTCCCATTGAAGGCATTATCTTTGGAGGCCGTAGACCTGCTGGT
NM_002591.3       GAGTCTCCGGAAGGTGTTCCCATTGAAGGCATTATCTTTGGAGGCCGTAGACCTGCTGGT
                  ************************************************************

HsCD00301003      GTCCCTCTAGTCTATGAAGCTCTCAGCTGGCAACATGGAGTCTTTGTGGGGGCGGCCATG
NM_002591.3       GTCCCTCTAGTCTATGAAGCTCTCAGCTGGCAACATGGAGTCTTTGTGGGGGCGGCCATG
                  ************************************************************

HsCD00301003      AGATCAGAGGCCACAGCGGCTGCAGAACATAAAGGCAAAATCATCATGCATGACCCCTTT
NM_002591.3       AGATCAGAGGCCACAGCGGCTGCAGAACATAAAGGCAAAATCATCATGCATGACCCCTTT
                  ************************************************************

HsCD00301003      GCCATGCGGCCCTTCTTTGGCTACAACTTCGGCAAATACCTGGCCCACTGGCTTAGCATG
NM_002591.3       GCCATGCGGCCCTTCTTTGGCTACAACTTCGGCAAATACCTGGCCCACTGGCTTAGCATG
                  ************************************************************

HsCD00301003      GCCCAGCACCCAGCAGCCAAACTGCCCAAGATCTTCCATGTCAACTGGTTCCGGAAGGAC
NM_002591.3       GCCCAGCACCCAGCAGCCAAACTGCCCAAGATCTTCCATGTCAACTGGTTCCGGAAGGAC
                  ************************************************************

HsCD00301003      AAGGAAGGCAAATTCCTCTGGCCAGGCTTTGGAGAGAACTCCAGGGTGCTGGAGTGGATG
NM_002591.3       AAGGAAGGCAAATTCCTCTGGCCAGGCTTTGGAGAGAACTCCAGGGTGCTGGAGTGGATG
                  ************************************************************

HsCD00301003      TTCAACCGGATCGATGGAAAAGCCAGCACCAAGCTCACGCCCATAGGCTACATCCCCAAG
NM_002591.3       TTCAACCGGATCGATGGAAAAGCCAGCACCAAGCTCACGCCCATAGGCTACATCCCCAAG
                  ************************************************************

HsCD00301003      GAGGATGCCCTGAACCTGAAAGGCCTGGGGCACATCAACATGATGGAGCTTTTCAGCATC
NM_002591.3       GAGGATGCCCTGAACCTGAAAGGCCTGGGGCACATCAACATGATGGAGCTTTTCAGCATC
                  ************************************************************

HsCD00301003      TCCAAGGAATTCTGGGAGAAGGAGGTGGAAGACATCGAGAAGTATCTGGAGGATCAAGTC
NM_002591.3       TCCAAGGAATTCTGGGAGAAGGAGGTGGAAGACATCGAGAAGTATCTGGAGGATCAAGTC
                  ************************************************************

HsCD00301003      AATGCCGACCTCCCCTGTGAAATCGAGAGAGAGATCCTTGCCTTGAAGCAAAGAATAAGC
NM_002591.3       AATGCCGACCTCCCCTGTGAAATCGAGAGAGAGATCCTTGCCTTGAAGCAAAGAATAAGC
                  ************************************************************

HsCD00301003      CAGATGTTG
NM_002591.3       CAGATGTAA
                  *******:.

Pathways

NCI : FOXA2 and FOXA3 transcription factor networks
Panther : Pyruvate metabolism
Reactome : Abacavir metabolism
Reactome : Abacavir transport and metabolism
Reactome : Developmental Biology
Reactome : Disease
Reactome : Gluconeogenesis
Reactome : Glucose metabolism
Reactome : Glycogen storage diseases
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Myoclonic epilepsy of Lafora
Reactome : Transcriptional regulation of white adipocyte differentiation
WikiPathway : Adipogenesis
WikiPathway : Glycolysis and Gluconeogenesis

Protein

UniProt : P35558
HPRD : 02028

Clone

Cloning Information : 231893
HIP Master Clone ID : 134776
Original Clone ID : FLH231893.01L

Organism


TAX_ID : 9606
Species Specific ID: 5105

Genome

Chromosome : 20
Map Location : 20q13.31
Ensembl : ENSG00000124253

Reagents

Labome : PCK1-antibody