DNASU Plasmid Repository • 480.965.5697 | Email

DNAJB1 (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  DNAJB1
Gene Name:  DnaJ (Hsp40) homolog, subfamily B, member 1
Sequence              Map: pANT7_cGST.doc
Original Clone ID: FLH271642.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: HIP
Description: None
Comments: This clone is identical to HsCD00603371
Mutation/
Discrepancy :
No / No
Publications: PMID: 23359685
Title: Hsp70/Hsp90 chaperone machinery is involved in the assembly of the purinosome
PMID: 24352439
Title: Large-scale production and structural and biophysical characterizations of the human hepatitis B virus polymerase.
Authors:
HsCD00301392

Price:  Login for Pricing
UNAVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1023nts         Open reading frame : 1 to 1023
Reference Sequence Alignment

ATGGGTAAAGACTACTACCAGACGTTGGGCCTGGCCCGCGGCGCGTCGGACGAGGAGATC
AAGCGGGCCTACCGCCGCCAGGCGCTGCGCTACCACCCGGACAAGAACAAGGAGCCCGGC
GCCGAGGAGAAGTTCAAGGAGATCGCTGAGGCCTACGACGTGCTCAGCGACCCGCGCAAG
CGCGAGATCTTCGACCGCTACGGGGAGGAAGGCCTAAAGGGGAGTGGCCCCAGTGGCGGT
AGCGGCGGTGGTGCCAATGGTACCTCTTTCAGCTACACATTCCATGGAGACCCTCATGCC
ATGTTTGCTGAGTTCTTCGGTGGCAGAAATCCCTTTGACACCTTTTTTGGGCAGCGGAAC
GGGGAGGAAGGCATGGACATTGATGACCCATTCTCTGGCTTCCCTATGGGCATGGGTGGC
TTCACCAACGTGAACTTTGGCCGCTCCCGCTCTGCCCAAGAGCCCGCCCGAAAGAAGCAA
GATCCCCCAGTCACCCACGACCTTCGAGTCTCCCTTGAAGAGATCTACAGCGGCTGTACC
AAGAAGATGAAAATCTCCCACAAGCGGCTAAACCCCGACGGAAAGAGCATTCGAAACGAA
GACAAAATATTGACCATCGAAGTGAAGAAGGGGTGGAAAGAAGGAACCAAAATCACTTTC
CCCAAGGAAGGAGACCAGACCTCCAACAACATTCCAGCTGATATCGTCTTTGTTTTAAAG
GACAAGCCCCACAATATCTTTAAGAGAGATGGCTCTGATGTCATTTATCCTGCCAGGATC
AGCCTCCGGGAGGCTCTGTGTGGCTGCACAGTGAACGTCCCCACTCTGGACGGCAGGACG
ATACCCGTCGTATTCAAAGATGTTATCAGGCCTGGCATGCGGCGAAAAGTTCCTGGAGAA
GGCCTCCCCCTCCCCAAAACACCCGAGAAACGTGGGGACCTCATTATTGAGTTTGAAGTG
ATCTTCCCCGAAAGGATTCCCCAGACATCAAGAACCGTACTTGAGCAGGTTCTTCCAATA
GAC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1057
Start on reference sequence 35
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : DNAJB1
Symbol Nomenclature : DNAJB1
SYNONYM : HSPF1; Hdj1; Hsp40; RSPH16B; Sis1
Designation : DnaJ (Hsp40) homolog, subfmaily B, member 1|dnaJ homolog subfamily B member 1|dnaJ protein homolog 1|hDj-1|heat shock 40 kDa protein 1|heat shock 40kD protein 1|heat shock protein 40|human DnaJ protein 1|radial spoke 16 homolog B
Full Nomenclature : DnaJ (Hsp40) homolog, subfamily B, member 1
GENEID : 3337
SYNONYM : HsCD00603371
HGNC : 5270
MIM : 604572
Vega : OTTHUMG00000183289
Target GenBank: BC002352

 

Reference Sequence Alignment

  

HsCD00301392      ATGGGTAAAGACTACTACCAGACGTTGGGCCTGGCCCGCGGCGCGTCGGACGAGGAGATC
NM_006145.1       ATGGGTAAAGACTACTACCAGACGTTGGGCCTGGCCCGCGGCGCGTCGGACGAGGAGATC
                  ************************************************************

HsCD00301392      AAGCGGGCCTACCGCCGCCAGGCGCTGCGCTACCACCCGGACAAGAACAAGGAGCCCGGC
NM_006145.1       AAGCGGGCCTACCGCCGCCAGGCGCTGCGCTACCACCCGGACAAGAACAAGGAGCCCGGC
                  ************************************************************

HsCD00301392      GCCGAGGAGAAGTTCAAGGAGATCGCTGAGGCCTACGACGTGCTCAGCGACCCGCGCAAG
NM_006145.1       GCCGAGGAGAAGTTCAAGGAGATCGCTGAGGCCTACGACGTGCTCAGCGACCCGCGCAAG
                  ************************************************************

HsCD00301392      CGCGAGATCTTCGACCGCTACGGGGAGGAAGGCCTAAAGGGGAGTGGCCCCAGTGGCGGT
NM_006145.1       CGCGAGATCTTCGACCGCTACGGGGAGGAAGGCCTAAAGGGGAGTGGCCCCAGTGGCGGT
                  ************************************************************

HsCD00301392      AGCGGCGGTGGTGCCAATGGTACCTCTTTCAGCTACACATTCCATGGAGACCCTCATGCC
NM_006145.1       AGCGGCGGTGGTGCCAATGGTACCTCTTTCAGCTACACATTCCATGGAGACCCTCATGCC
                  ************************************************************

HsCD00301392      ATGTTTGCTGAGTTCTTCGGTGGCAGAAATCCCTTTGACACCTTTTTTGGGCAGCGGAAC
NM_006145.1       ATGTTTGCTGAGTTCTTCGGTGGCAGAAATCCCTTTGACACCTTTTTTGGGCAGCGGAAC
                  ************************************************************

HsCD00301392      GGGGAGGAAGGCATGGACATTGATGACCCATTCTCTGGCTTCCCTATGGGCATGGGTGGC
NM_006145.1       GGGGAGGAAGGCATGGACATTGATGACCCATTCTCTGGCTTCCCTATGGGCATGGGTGGC
                  ************************************************************

HsCD00301392      TTCACCAACGTGAACTTTGGCCGCTCCCGCTCTGCCCAAGAGCCCGCCCGAAAGAAGCAA
NM_006145.1       TTCACCAACGTGAACTTTGGCCGCTCCCGCTCTGCCCAAGAGCCCGCCCGAAAGAAGCAA
                  ************************************************************

HsCD00301392      GATCCCCCAGTCACCCACGACCTTCGAGTCTCCCTTGAAGAGATCTACAGCGGCTGTACC
NM_006145.1       GATCCCCCAGTCACCCACGACCTTCGAGTCTCCCTTGAAGAGATCTACAGCGGCTGTACC
                  ************************************************************

HsCD00301392      AAGAAGATGAAAATCTCCCACAAGCGGCTAAACCCCGACGGAAAGAGCATTCGAAACGAA
NM_006145.1       AAGAAGATGAAAATCTCCCACAAGCGGCTAAACCCCGACGGAAAGAGCATTCGAAACGAA
                  ************************************************************

HsCD00301392      GACAAAATATTGACCATCGAAGTGAAGAAGGGGTGGAAAGAAGGAACCAAAATCACTTTC
NM_006145.1       GACAAAATATTGACCATCGAAGTGAAGAAGGGGTGGAAAGAAGGAACCAAAATCACTTTC
                  ************************************************************

HsCD00301392      CCCAAGGAAGGAGACCAGACCTCCAACAACATTCCAGCTGATATCGTCTTTGTTTTAAAG
NM_006145.1       CCCAAGGAAGGAGACCAGACCTCCAACAACATTCCAGCTGATATCGTCTTTGTTTTAAAG
                  ************************************************************

HsCD00301392      GACAAGCCCCACAATATCTTTAAGAGAGATGGCTCTGATGTCATTTATCCTGCCAGGATC
NM_006145.1       GACAAGCCCCACAATATCTTTAAGAGAGATGGCTCTGATGTCATTTATCCTGCCAGGATC
                  ************************************************************

HsCD00301392      AGCCTCCGGGAGGCTCTGTGTGGCTGCACAGTGAACGTCCCCACTCTGGACGGCAGGACG
NM_006145.1       AGCCTCCGGGAGGCTCTGTGTGGCTGCACAGTGAACGTCCCCACTCTGGACGGCAGGACG
                  ************************************************************

HsCD00301392      ATACCCGTCGTATTCAAAGATGTTATCAGGCCTGGCATGCGGCGAAAAGTTCCTGGAGAA
NM_006145.1       ATACCCGTCGTATTCAAAGATGTTATCAGGCCTGGCATGCGGCGAAAAGTTCCTGGAGAA
                  ************************************************************

HsCD00301392      GGCCTCCCCCTCCCCAAAACACCCGAGAAACGTGGGGACCTCATTATTGAGTTTGAAGTG
NM_006145.1       GGCCTCCCCCTCCCCAAAACACCCGAGAAACGTGGGGACCTCATTATTGAGTTTGAAGTG
                  ************************************************************

HsCD00301392      ATCTTCCCCGAAAGGATTCCCCAGACATCAAGAACCGTACTTGAGCAGGTTCTTCCAATA
NM_006145.1       ATCTTCCCCGAAAGGATTCCCCAGACATCAAGAACCGTACTTGAGCAGGTTCTTCCAATA
                  ************************************************************

HsCD00301392      GAC
NM_006145.1       TAG
                   * 

Pathways

Reactome : Attenuation phase
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : HSF1 activation
Reactome : HSF1-dependent transactivation
Reactome : Regulation of HSF1-mediated heat shock response
WikiPathway : Epithelium TarBase
WikiPathway : Leukocyte TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Squamous cell TarBase

Protein

SMART domain : DnaJ : DnaJ molecular chaperone homology domain
UniProt : Q6FHS4
UniProt : P25685
HPRD : 05198

Clone

Cloning Information : 271642
HIP Master Clone ID : 107191
Original Clone ID : FLH271642.01L

Organism


TAX_ID : 9606
Species Specific ID: 3337

Genome

Chromosome : 19
Map Location : 19p13.2
Ensembl : ENSG00000132002

Reagents

Labome : Hsp40-antibody