DNASU Plasmid Repository • 480.965.5697 | Email

RBBP4 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RBBP4
Gene Name:  retinoblastoma binding protein 4
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH014621.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003017

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1278nts         Open reading frame : 1 to 1278
Reference Sequence Alignment

ATGGCCGACAAGGAAGCAGCCTTCGACGACGCAGTGGAAGAACGAGTGATCAACGAGGAA
TACAAAATATGGAAAAAGAACACCCCTTTTCTTTATGATTTGGTGATGACCCATGCTCTG
GAGTGGCCCAGCCTAACTGCCCAGTGGCTTCCAGATGTAACCAGACCAGAAGGGAAAGAT
TTCAGCATTCATCGACTTGTCCTGGGGACACACACATCGGATGAACAAAACCATCTTGTT
ATAGCCAGTGTGCAGCTCCCTAATGATGATGCTCAGTTTGATGCGTCACACTACGACAGT
GAGAAAGGAGAATTTGGAGGTTTTGGTTCAGTTAGTGGAAAAATTGAAATAGAAATCAAG
ATCAACCATGAAGGAGAAGTAAACAGGGCCCGTTATATGCCCCAGAACCCTTGTATCATC
GCAACAAAGACTCCTTCCAGTGATGTTCTTGTCTTTGACTATACAAAACATCCTTCTAAA
CCAGATCCTTCTGGAGAGTGCAACCCAGACTTGCGTCTCCGTGGACATCAGAAGGAAGGC
TATGGGCTTTCTTGGAACCCAAATCTCAGTGGGCACTTACTTAGTGCTTCAGATGACCAT
ACCATCTGCCTGTGGGACATCAGTGCCGTTCCAAAGGAGGGAAAAGTGGTAGATGCGAAG
ACCATCTTTACAGGGCATACGGCAGTAGTAGAAGATGTTTCCTGGCATCTACTCCATGAG
TCTCTGTTTGGGTCAGTTGCTGATGATCAGAAACTTATGATTTGGGATACTCGTTCAAAC
AATACTTCCAAACCCAGCCACTCAGTTGATGCTCACACTGCTGAAGTGAACTGCCTTTCT
TTCAATCCTTATAGTGAGTTCATTCTTGCCACAGGATCAGCTGACAAGACTGTTGCCTTG
TGGGATCTGAGAAATCTGAAACTTAAGTTGCATTCCTTTGAGTCACATAAGGATGAAATA
TTCCAGGTTCAGTGGTCACCTCACAATGAGACTATTTTAGCTTCCAGTGGTACTGATCGC
AGACTGAATGTCTGGGATTTAAGTAAAATTGGAGAGGAACAATCCCCAGAAGATGCAGAA
GACGGGCCACCAGAGTTGTTGTTTATTCATGGTGGTCATACTGCCAAGATATCTGATTTC
TCCTGGAATCCCAATGAACCTTGGGTGATTTGTTCTGTATCAGAAGACAATATCATGCAA
GTGTGGCAAATGGCAGAGAACATTTATAATGATGAAGACCCTGAAGGAAGCGTGGATCCA
GAAGGACAAGGGTCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1364
Start on reference sequence 87
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RBBP4
Symbol Nomenclature : RBBP4
SYNONYM : NURF55; RBAP48
Designation : CAF-1 subunit C|CAF-I 48 kDa subunit|CAF-I p48|MSI1 protein homolog|RBBP-4|chromatin assembly factor 1 subunit C|chromatin assembly factor I p48 subunit|chromatin assembly factor/CAF-1 p48 subunit|histone-binding protein RBBP4|nucleosome-remodeling factor subunit RBAP48|retinoblastoma-binding protein 4|retinoblastoma-binding protein p48
Full Nomenclature : retinoblastoma binding protein 4
GENEID : 5928
GI : 60655332
GenBank Accession : AY889439
HGNC : 9887
MIM : 602923
Vega : OTTHUMG00000007998
Target GenBank: BC003092

 

Reference Sequence Alignment

  

HsCD00003017        ATGGCCGACAAGGAAGCAGCCTTCGACGACGCAGTGGAAGAACGAGTGATCAACGAGGAA
NM_001135255.1      ---ATGGCCGACAAGGAAGCCTTCGACGACGCAGTGGAAGAACGAGTGATCAACGAGGAA
NM_005610.2         ATGGCCGACAAGGAAGCAGCCTTCGACGACGCAGTGGAAGAACGAGTGATCAACGAGGAA
NM_001135256.1      ------------------------------------------------------------
                                                                                

HsCD00003017        TACAAAATATGGAAAAAGAACACCCCTTTTCTTTATGATTTGGTGATGACCCATGCTCTG
NM_001135255.1      TACAAAATATGGAAAAAGAACACCCCTTTTCTTTATGATTTGGTGATGACCCATGCTCTG
NM_005610.2         TACAAAATATGGAAAAAGAACACCCCTTTTCTTTATGATTTGGTGATGACCCATGCTCTG
NM_001135256.1      ---------------------------------------------ATGACCCATGCTCTG
                                                                 ***************

HsCD00003017        GAGTGGCCCAGCCTAACTGCCCAGTGGCTTCCAGATGTAACCAGACCAGAAGGGAAAGAT
NM_001135255.1      GAGTGGCCCAGCCTAACTGCCCAGTGGCTTCCAGATGTAACCAGACCAGAAGGGAAAGAT
NM_005610.2         GAGTGGCCCAGCCTAACTGCCCAGTGGCTTCCAGATGTAACCAGACCAGAAGGGAAAGAT
NM_001135256.1      GAGTGGCCCAGCCTAACTGCCCAGTGGCTTCCAGATGTAACCAGACCAGAAGGGAAAGAT
                    ************************************************************

HsCD00003017        TTCAGCATTCATCGACTTGTCCTGGGGACACACACATCGGATGAACAAAACCATCTTGTT
NM_001135255.1      TTCAGCATTCATCGACTTGTCCTGGGGACACACACATCGGATGAACAAAACCATCTTGTT
NM_005610.2         TTCAGCATTCATCGACTTGTCCTGGGGACACACACATCGGATGAACAAAACCATCTTGTT
NM_001135256.1      TTCAGCATTCATCGACTTGTCCTGGGGACACACACATCGGATGAACAAAACCATCTTGTT
                    ************************************************************

HsCD00003017        ATAGCCAGTGTGCAGCTCCCTAATGATGATGCTCAGTTTGATGCGTCACACTACGACAGT
NM_001135255.1      ATAGCCAGTGTGCAGCTCCCTAATGATGATGCTCAGTTTGATGCGTCACACTACGACAGT
NM_005610.2         ATAGCCAGTGTGCAGCTCCCTAATGATGATGCTCAGTTTGATGCGTCACACTACGACAGT
NM_001135256.1      ATAGCCAGTGTGCAGCTCCCTAATGATGATGCTCAGTTTGATGCGTCACACTACGACAGT
                    ************************************************************

HsCD00003017        GAGAAAGGAGAATTTGGAGGTTTTGGTTCAGTTAGTGGAAAAATTGAAATAGAAATCAAG
NM_001135255.1      GAGAAAGGAGAATTTGGAGGTTTTGGTTCAGTTAGTGGAAAAATTGAAATAGAAATCAAG
NM_005610.2         GAGAAAGGAGAATTTGGAGGTTTTGGTTCAGTTAGTGGAAAAATTGAAATAGAAATCAAG
NM_001135256.1      GAGAAAGGAGAATTTGGAGGTTTTGGTTCAGTTAGTGGAAAAATTGAAATAGAAATCAAG
                    ************************************************************

HsCD00003017        ATCAACCATGAAGGAGAAGTAAACAGGGCCCGTTATATGCCCCAGAACCCTTGTATCATC
NM_001135255.1      ATCAACCATGAAGGAGAAGTAAACAGGGCCCGTTATATGCCCCAGAACCCTTGTATCATC
NM_005610.2         ATCAACCATGAAGGAGAAGTAAACAGGGCCCGTTATATGCCCCAGAACCCTTGTATCATC
NM_001135256.1      ATCAACCATGAAGGAGAAGTAAACAGGGCCCGTTATATGCCCCAGAACCCTTGTATCATC
                    ************************************************************

HsCD00003017        GCAACAAAGACTCCTTCCAGTGATGTTCTTGTCTTTGACTATACAAAACATCCTTCTAAA
NM_001135255.1      GCAACAAAGACTCCTTCCAGTGATGTTCTTGTTTTTGACTATACAAAACATCCTTCTAAA
NM_005610.2         GCAACAAAGACTCCTTCCAGTGATGTTCTTGTTTTTGACTATACAAAACATCCTTCTAAA
NM_001135256.1      GCAACAAAGACTCCTTCCAGTGATGTTCTTGTTTTTGACTATACAAAACATCCTTCTAAA
                    ******************************** ***************************

HsCD00003017        CCAGATCCTTCTGGAGAGTGCAACCCAGACTTGCGTCTCCGTGGACATCAGAAGGAAGGC
NM_001135255.1      CCAGATCCTTCTGGAGAGTGCAACCCAGACTTGCGTCTCCGTGGACATCAGAAGGAAGGC
NM_005610.2         CCAGATCCTTCTGGAGAGTGCAACCCAGACTTGCGTCTCCGTGGACATCAGAAGGAAGGC
NM_001135256.1      CCAGATCCTTCTGGAGAGTGCAACCCAGACTTGCGTCTCCGTGGACATCAGAAGGAAGGC
                    ************************************************************

HsCD00003017        TATGGGCTTTCTTGGAACCCAAATCTCAGTGGGCACTTACTTAGTGCTTCAGATGACCAT
NM_001135255.1      TATGGGCTTTCTTGGAACCCAAATCTCAGTGGGCACTTACTTAGTGCTTCAGATGACCAT
NM_005610.2         TATGGGCTTTCTTGGAACCCAAATCTCAGTGGGCACTTACTTAGTGCTTCAGATGACCAT
NM_001135256.1      TATGGGCTTTCTTGGAACCCAAATCTCAGTGGGCACTTACTTAGTGCTTCAGATGACCAT
                    ************************************************************

HsCD00003017        ACCATCTGCCTGTGGGACATCAGTGCCGTTCCAAAGGAGGGAAAAGTGGTAGATGCGAAG
NM_001135255.1      ACCATCTGCCTGTGGGACATCAGTGCCGTTCCAAAGGAGGGAAAAGTGGTAGATGCGAAG
NM_005610.2         ACCATCTGCCTGTGGGACATCAGTGCCGTTCCAAAGGAGGGAAAAGTGGTAGATGCGAAG
NM_001135256.1      ACCATCTGCCTGTGGGACATCAGTGCCGTTCCAAAGGAGGGAAAAGTGGTAGATGCGAAG
                    ************************************************************

HsCD00003017        ACCATCTTTACAGGGCATACGGCAGTAGTAGAAGATGTTTCCTGGCATCTACTCCATGAG
NM_001135255.1      ACCATCTTTACAGGGCATACGGCAGTAGTAGAAGATGTTTCCTGGCATCTACTCCATGAG
NM_005610.2         ACCATCTTTACAGGGCATACGGCAGTAGTAGAAGATGTTTCCTGGCATCTACTCCATGAG
NM_001135256.1      ACCATCTTTACAGGGCATACGGCAGTAGTAGAAGATGTTTCCTGGCATCTACTCCATGAG
                    ************************************************************

HsCD00003017        TCTCTGTTTGGGTCAGTTGCTGATGATCAGAAACTTATGATTTGGGATACTCGTTCAAAC
NM_001135255.1      TCTCTGTTTGGGTCAGTTGCTGATGATCAGAAACTTATGATTTGGGATACTCGTTCAAAC
NM_005610.2         TCTCTGTTTGGGTCAGTTGCTGATGATCAGAAACTTATGATTTGGGATACTCGTTCAAAC
NM_001135256.1      TCTCTGTTTGGGTCAGTTGCTGATGATCAGAAACTTATGATTTGGGATACTCGTTCAAAC
                    ************************************************************

HsCD00003017        AATACTTCCAAACCCAGCCACTCAGTTGATGCTCACACTGCTGAAGTGAACTGCCTTTCT
NM_001135255.1      AATACTTCCAAACCAAGCCACTCAGTTGATGCTCACACTGCTGAAGTGAACTGCCTTTCT
NM_005610.2         AATACTTCCAAACCAAGCCACTCAGTTGATGCTCACACTGCTGAAGTGAACTGCCTTTCT
NM_001135256.1      AATACTTCCAAACCAAGCCACTCAGTTGATGCTCACACTGCTGAAGTGAACTGCCTTTCT
                    **************.*********************************************

HsCD00003017        TTCAATCCTTATAGTGAGTTCATTCTTGCCACAGGATCAGCTGACAAGACTGTTGCCTTG
NM_001135255.1      TTCAATCCTTATAGTGAGTTCATTCTTGCCACAGGATCAGCTGACAAGACTGTTGCCTTG
NM_005610.2         TTCAATCCTTATAGTGAGTTCATTCTTGCCACAGGATCAGCTGACAAGACTGTTGCCTTG
NM_001135256.1      TTCAATCCTTATAGTGAGTTCATTCTTGCCACAGGATCAGCTGACAAGACTGTTGCCTTG
                    ************************************************************

HsCD00003017        TGGGATCTGAGAAATCTGAAACTTAAGTTGCATTCCTTTGAGTCACATAAGGATGAAATA
NM_001135255.1      TGGGATCTGAGAAATCTGAAACTTAAGTTGCATTCCTTTGAGTCACATAAGGATGAAATA
NM_005610.2         TGGGATCTGAGAAATCTGAAACTTAAGTTGCATTCCTTTGAGTCACATAAGGATGAAATA
NM_001135256.1      TGGGATCTGAGAAATCTGAAACTTAAGTTGCATTCCTTTGAGTCACATAAGGATGAAATA
                    ************************************************************

HsCD00003017        TTCCAGGTTCAGTGGTCACCTCACAATGAGACTATTTTAGCTTCCAGTGGTACTGATCGC
NM_001135255.1      TTCCAGGTTCAGTGGTCACCTCACAATGAGACTATTTTAGCTTCCAGTGGTACTGATCGC
NM_005610.2         TTCCAGGTTCAGTGGTCACCTCACAATGAGACTATTTTAGCTTCCAGTGGTACTGATCGC
NM_001135256.1      TTCCAGGTTCAGTGGTCACCTCACAATGAGACTATTTTAGCTTCCAGTGGTACTGATCGC
                    ************************************************************

HsCD00003017        AGACTGAATGTCTGGGATTTAAGTAAAATTGGAGAGGAACAATCCCCAGAAGATGCAGAA
NM_001135255.1      AGACTGAATGTCTGGGATTTAAGTAAAATTGGAGAGGAACAATCCCCAGAAGATGCAGAA
NM_005610.2         AGACTGAATGTCTGGGATTTAAGTAAAATTGGAGAGGAACAATCCCCAGAAGATGCAGAA
NM_001135256.1      AGACTGAATGTCTGGGATTTAAGTAAAATTGGAGAGGAACAATCCCCAGAAGATGCAGAA
                    ************************************************************

HsCD00003017        GACGGGCCACCAGAGTTGTTGTTTATTCATGGTGGTCATACTGCCAAGATATCTGATTTC
NM_001135255.1      GACGGGCCACCAGAGTTGTTGTTTATTCATGGTGGTCATACTGCCAAGATATCTGATTTC
NM_005610.2         GACGGGCCACCAGAGTTGTTGTTTATTCATGGTGGTCATACTGCCAAGATATCTGATTTC
NM_001135256.1      GACGGGCCACCAGAGTTGTTGTTTATTCATGGTGGTCATACTGCCAAGATATCTGATTTC
                    ************************************************************

HsCD00003017        TCCTGGAATCCCAATGAACCTTGGGTGATTTGTTCTGTATCAGAAGACAATATCATGCAA
NM_001135255.1      TCCTGGAATCCCAATGAACCTTGGGTGATTTGTTCTGTATCAGAAGACAATATCATGCAA
NM_005610.2         TCCTGGAATCCCAATGAACCTTGGGTGATTTGTTCTGTATCAGAAGACAATATCATGCAA
NM_001135256.1      TCCTGGAATCCCAATGAACCTTGGGTGATTTGTTCTGTATCAGAAGACAATATCATGCAA
                    ************************************************************

HsCD00003017        GTGTGGCAAATGGCAGAGAACATTTATAATGATGAAGACCCTGAAGGAAGCGTGGATCCA
NM_001135255.1      GTGTGGCAAATGGCAGAGAACATTTATAATGATGAAGACCCTGAAGGAAGCGTGGATCCA
NM_005610.2         GTGTGGCAAATGGCAGAGAACATTTATAATGATGAAGACCCTGAAGGAAGCGTGGATCCA
NM_001135256.1      GTGTGGCAAATGGCAGAGAACATTTATAATGATGAAGACCCTGAAGGAAGCGTGGATCCA
                    ************************************************************

HsCD00003017        GAAGGACAAGGGTCCTAG
NM_001135255.1      GAAGGACAAGGGTCCTAG
NM_005610.2         GAAGGACAAGGGTCCTAG
NM_001135256.1      GAAGGACAAGGGTCCTAG
                    ******************

Pathways

NCI : E2F transcription factor network
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : Regulation of Telomerase
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Regulation of retinoblastoma protein
NCI : Signaling events mediated by HDAC Class I
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Chromosome Maintenance
Reactome : Deposition of new CENPA-containing nucleosomes at the centromere
Reactome : Epigenetic regulation of gene expression
Reactome : G0 and Early G1
Reactome : G2/M Transition
Reactome : Gene Expression
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Nucleosome assembly
Reactome : Oxidative Stress Induced Senescence
Reactome : PRC2 methylates histones and DNA
Reactome : Polo-like kinase mediated events
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I Transcription Initiation
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : Transcription

Protein

SMART domain : WD40 : WD40 repeats
UniProt : Q09028
HPRD : 04232

Clone

Cloning Information : 14621
HIP Master Clone ID : 28820
Original Clone ID : FLH014621.01X

Organism


TAX_ID : 9606
Species Specific ID: 5928

Genome

Chromosome : 1
Map Location : 1p35.1
Ensembl : ENSG00000162521

Reagents

Labome : RbAp48-antibody