DNASU Plasmid Repository • 480.965.5697 | Email

P2RY5 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  LPAR6
Gene Name:  lysophosphatidic acid receptor 6
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH272261.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: BMS
Description: None
Comments: Clone insert was fully sequence-verified by the clone submitter but the sequence is not available.
Mutation/
Discrepancy :
Unknown / Unknown
Publications: None
Authors: Bristol-Myers Squibb
HsCD00305164

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1035nts         Open reading frame : 1 to 1035
Reference Sequence Alignment

ATGGTAAGCGTTAACAGCTCCCACTGCTTCTATAATGACTCCTTTAAGTACACTTTGTAT
GGGTGCATGTTCAGCATGGTGTTTGTGCTTGGGTTAATATCCAATTGTGTTGCCATATAC
ATTTTCATCTGCGTCCTCAAAGTCCGAAATGAAACTACAACTTACATGATTAACTTGGCA
ATGTCAGACTTGCTTTTTGTTTTTACTTTACCCTTCAGGATTTTTTACTTCACAACACGG
AATTGGCCATTTGGAGATTTACTTTGTAAGATTTCTGTGATGCTGTTTTATACCAACATG
TACGGAAGCATTCTGTTCTTAACCTGTATTAGTGTAGATCGATTTCTGGCAATTGTCTAC
CCATTTAAGTCAAAGACTCTAAGAACCAAAAGAAATGCAAAGATTGTTTGCACTGGCGTG
TGGTTAACTGTGATCGGAGGAAGTGCACCCGCCGTTTTTGTTCAGTCTACCCACTCTCAG
GGTAACAATGCCTCAGAAGCCTGCTTTGAAAATTTTCCAGAAGCCACATGGAAAACATAT
CTCTCAAGGATTGTAATTTTCATCGAAATAGTGGGATTTTTTATTCCTCTAATTTTAAAT
GTAACTTGTTCTAGTATGGTGCTAAAAACTTTAACCAAACCTGTTACATTAAGTAGAAGC
AAAATAAACAAAACTAAGGTTTTAAAAATGATTTTTGTACATTTGATCATATTCTGTTTC
TGTTTTGTTCCTTACAATATCAATCTTATTTTATATTCTCTTGTGAGAACACAAACATTT
GTTAATTGCTCAGTAGTGGCAGCAGTAAGGACAATGTACCCAATCACTCTCTGTATTGCT
GTTTCCAACTGTTGTTTTGACCCTATAGTTTACTACTTTACATCGGACACAATTCAGAAT
TCAATAAAAATGAAAAACTGGTCTGTCAGGAGAAGTGACTTCAGATTCTCTGAAGTTCAT
GGTGCAGAGAATTTTATTCAGCATAACCTACAGACCTTAAAAAGTAAGATATTTGACAAT
GAATCTGCTGCCTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1834
Start on reference sequence 800
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome

Gene

 

Gene Symbol : LPAR6
Symbol Nomenclature : LPAR6
SYNONYM : ARWH1; LAH3; P2RY5; P2Y5
Designation : G-protein coupled purinergic receptor P2Y5|LPA receptor 6|LPA-6|P2Y purinoceptor 5|RB intron encoded G-protein coupled receptor|oleoyl-L-alpha-lysophosphatidic acid receptor|purinergic receptor 5|purinergic receptor P2Y G protein-coupled protein 5|purinergic receptor P2Y, G-protein coupled, 5
Full Nomenclature : lysophosphatidic acid receptor 6
GENEID : 10161
HGNC : 15520
MIM : 609239
Vega : OTTHUMG00000016895
Target GenBank: NM_005767

 

Reference Sequence Alignment

  

HsCD00305164        ATGGTAAGCGTTAACAGCTCCCACTGCTTCTATAATGACTCCTTTAAGTACACTTTGTAT
NM_001162497.1      ATGGTAAGCGTTAACAGCTCCCACTGCTTCTATAATGACTCCTTTAAGTACACTTTGTAT
NM_001162498.1      ATGGTAAGCGTTAACAGCTCCCACTGCTTCTATAATGACTCCTTTAAGTACACTTTGTAT
NM_005767.5         ATGGTAAGCGTTAACAGCTCCCACTGCTTCTATAATGACTCCTTTAAGTACACTTTGTAT
                    ************************************************************

HsCD00305164        GGGTGCATGTTCAGCATGGTGTTTGTGCTTGGGTTAATATCCAATTGTGTTGCCATATAC
NM_001162497.1      GGGTGCATGTTCAGCATGGTGTTTGTGCTTGGGTTAATATCCAATTGTGTTGCCATATAC
NM_001162498.1      GGGTGCATGTTCAGCATGGTGTTTGTGCTTGGGTTAATATCCAATTGTGTTGCCATATAC
NM_005767.5         GGGTGCATGTTCAGCATGGTGTTTGTGCTTGGGTTAATATCCAATTGTGTTGCCATATAC
                    ************************************************************

HsCD00305164        ATTTTCATCTGCGTCCTCAAAGTCCGAAATGAAACTACAACTTACATGATTAACTTGGCA
NM_001162497.1      ATTTTCATCTGCGTCCTCAAAGTCCGAAATGAAACTACAACTTACATGATTAACTTGGCA
NM_001162498.1      ATTTTCATCTGCGTCCTCAAAGTCCGAAATGAAACTACAACTTACATGATTAACTTGGCA
NM_005767.5         ATTTTCATCTGCGTCCTCAAAGTCCGAAATGAAACTACAACTTACATGATTAACTTGGCA
                    ************************************************************

HsCD00305164        ATGTCAGACTTGCTTTTTGTTTTTACTTTACCCTTCAGGATTTTTTACTTCACAACACGG
NM_001162497.1      ATGTCAGACTTGCTTTTTGTTTTTACTTTACCCTTCAGGATTTTTTACTTCACAACACGG
NM_001162498.1      ATGTCAGACTTGCTTTTTGTTTTTACTTTACCCTTCAGGATTTTTTACTTCACAACACGG
NM_005767.5         ATGTCAGACTTGCTTTTTGTTTTTACTTTACCCTTCAGGATTTTTTACTTCACAACACGG
                    ************************************************************

HsCD00305164        AATTGGCCATTTGGAGATTTACTTTGTAAGATTTCTGTGATGCTGTTTTATACCAACATG
NM_001162497.1      AATTGGCCATTTGGAGATTTACTTTGTAAGATTTCTGTGATGCTGTTTTATACCAACATG
NM_001162498.1      AATTGGCCATTTGGAGATTTACTTTGTAAGATTTCTGTGATGCTGTTTTATACCAACATG
NM_005767.5         AATTGGCCATTTGGAGATTTACTTTGTAAGATTTCTGTGATGCTGTTTTATACCAACATG
                    ************************************************************

HsCD00305164        TACGGAAGCATTCTGTTCTTAACCTGTATTAGTGTAGATCGATTTCTGGCAATTGTCTAC
NM_001162497.1      TACGGAAGCATTCTGTTCTTAACCTGTATTAGTGTAGATCGATTTCTGGCAATTGTCTAC
NM_001162498.1      TACGGAAGCATTCTGTTCTTAACCTGTATTAGTGTAGATCGATTTCTGGCAATTGTCTAC
NM_005767.5         TACGGAAGCATTCTGTTCTTAACCTGTATTAGTGTAGATCGATTTCTGGCAATTGTCTAC
                    ************************************************************

HsCD00305164        CCATTTAAGTCAAAGACTCTAAGAACCAAAAGAAATGCAAAGATTGTTTGCACTGGCGTG
NM_001162497.1      CCATTTAAGTCAAAGACTCTAAGAACCAAAAGAAATGCAAAGATTGTTTGCACTGGCGTG
NM_001162498.1      CCATTTAAGTCAAAGACTCTAAGAACCAAAAGAAATGCAAAGATTGTTTGCACTGGCGTG
NM_005767.5         CCATTTAAGTCAAAGACTCTAAGAACCAAAAGAAATGCAAAGATTGTTTGCACTGGCGTG
                    ************************************************************

HsCD00305164        TGGTTAACTGTGATCGGAGGAAGTGCACCCGCCGTTTTTGTTCAGTCTACCCACTCTCAG
NM_001162497.1      TGGTTAACTGTGATCGGAGGAAGTGCACCCGCCGTTTTTGTTCAGTCTACCCACTCTCAG
NM_001162498.1      TGGTTAACTGTGATCGGAGGAAGTGCACCCGCCGTTTTTGTTCAGTCTACCCACTCTCAG
NM_005767.5         TGGTTAACTGTGATCGGAGGAAGTGCACCCGCCGTTTTTGTTCAGTCTACCCACTCTCAG
                    ************************************************************

HsCD00305164        GGTAACAATGCCTCAGAAGCCTGCTTTGAAAATTTTCCAGAAGCCACATGGAAAACATAT
NM_001162497.1      GGTAACAATGCCTCAGAAGCCTGCTTTGAAAATTTTCCAGAAGCCACATGGAAAACATAT
NM_001162498.1      GGTAACAATGCCTCAGAAGCCTGCTTTGAAAATTTTCCAGAAGCCACATGGAAAACATAT
NM_005767.5         GGTAACAATGCCTCAGAAGCCTGCTTTGAAAATTTTCCAGAAGCCACATGGAAAACATAT
                    ************************************************************

HsCD00305164        CTCTCAAGGATTGTAATTTTCATCGAAATAGTGGGATTTTTTATTCCTCTAATTTTAAAT
NM_001162497.1      CTCTCAAGGATTGTAATTTTCATCGAAATAGTGGGATTTTTTATTCCTCTAATTTTAAAT
NM_001162498.1      CTCTCAAGGATTGTAATTTTCATCGAAATAGTGGGATTTTTTATTCCTCTAATTTTAAAT
NM_005767.5         CTCTCAAGGATTGTAATTTTCATCGAAATAGTGGGATTTTTTATTCCTCTAATTTTAAAT
                    ************************************************************

HsCD00305164        GTAACTTGTTCTAGTATGGTGCTAAAAACTTTAACCAAACCTGTTACATTAAGTAGAAGC
NM_001162497.1      GTAACTTGTTCTAGTATGGTGCTAAAAACTTTAACCAAACCTGTTACATTAAGTAGAAGC
NM_001162498.1      GTAACTTGTTCTAGTATGGTGCTAAAAACTTTAACCAAACCTGTTACATTAAGTAGAAGC
NM_005767.5         GTAACTTGTTCTAGTATGGTGCTAAAAACTTTAACCAAACCTGTTACATTAAGTAGAAGC
                    ************************************************************

HsCD00305164        AAAATAAACAAAACTAAGGTTTTAAAAATGATTTTTGTACATTTGATCATATTCTGTTTC
NM_001162497.1      AAAATAAACAAAACTAAGGTTTTAAAAATGATTTTTGTACATTTGATCATATTCTGTTTC
NM_001162498.1      AAAATAAACAAAACTAAGGTTTTAAAAATGATTTTTGTACATTTGATCATATTCTGTTTC
NM_005767.5         AAAATAAACAAAACTAAGGTTTTAAAAATGATTTTTGTACATTTGATCATATTCTGTTTC
                    ************************************************************

HsCD00305164        TGTTTTGTTCCTTACAATATCAATCTTATTTTATATTCTCTTGTGAGAACACAAACATTT
NM_001162497.1      TGTTTTGTTCCTTACAATATCAATCTTATTTTATATTCTCTTGTGAGAACACAAACATTT
NM_001162498.1      TGTTTTGTTCCTTACAATATCAATCTTATTTTATATTCTCTTGTGAGAACACAAACATTT
NM_005767.5         TGTTTTGTTCCTTACAATATCAATCTTATTTTATATTCTCTTGTGAGAACACAAACATTT
                    ************************************************************

HsCD00305164        GTTAATTGCTCAGTAGTGGCAGCAGTAAGGACAATGTACCCAATCACTCTCTGTATTGCT
NM_001162497.1      GTTAATTGCTCAGTAGTGGCAGCAGTAAGGACAATGTACCCAATCACTCTCTGTATTGCT
NM_001162498.1      GTTAATTGCTCAGTAGTGGCAGCAGTAAGGACAATGTACCCAATCACTCTCTGTATTGCT
NM_005767.5         GTTAATTGCTCAGTAGTGGCAGCAGTAAGGACAATGTACCCAATCACTCTCTGTATTGCT
                    ************************************************************

HsCD00305164        GTTTCCAACTGTTGTTTTGACCCTATAGTTTACTACTTTACATCGGACACAATTCAGAAT
NM_001162497.1      GTTTCCAACTGTTGTTTTGACCCTATAGTTTACTACTTTACATCGGACACAATTCAGAAT
NM_001162498.1      GTTTCCAACTGTTGTTTTGACCCTATAGTTTACTACTTTACATCGGACACAATTCAGAAT
NM_005767.5         GTTTCCAACTGTTGTTTTGACCCTATAGTTTACTACTTTACATCGGACACAATTCAGAAT
                    ************************************************************

HsCD00305164        TCAATAAAAATGAAAAACTGGTCTGTCAGGAGAAGTGACTTCAGATTCTCTGAAGTTCAT
NM_001162497.1      TCAATAAAAATGAAAAACTGGTCTGTCAGGAGAAGTGACTTCAGATTCTCTGAAGTTCAT
NM_001162498.1      TCAATAAAAATGAAAAACTGGTCTGTCAGGAGAAGTGACTTCAGATTCTCTGAAGTTCAT
NM_005767.5         TCAATAAAAATGAAAAACTGGTCTGTCAGGAGAAGTGACTTCAGATTCTCTGAAGTTCAT
                    ************************************************************

HsCD00305164        GGTGCAGAGAATTTTATTCAGCATAACCTACAGACCTTAAAAAGTAAGATATTTGACAAT
NM_001162497.1      GGTGCAGAGAATTTTATTCAGCATAACCTACAGACCTTAAAAAGTAAGATATTTGACAAT
NM_001162498.1      GGTGCAGAGAATTTTATTCAGCATAACCTACAGACCTTAAAAAGTAAGATATTTGACAAT
NM_005767.5         GGTGCAGAGAATTTTATTCAGCATAACCTACAGACCTTAAAAAGTAAGATATTTGACAAT
                    ************************************************************

HsCD00305164        GAATCTGCTGCCTGA
NM_001162497.1      GAATCTGCTGCCTGA
NM_001162498.1      GAATCTGCTGCCTGA
NM_005767.5         GAATCTGCTGCCTGA
                    ***************

Pathways

Reactome : Class A/1 (Rhodopsin-like receptors)
Reactome : G alpha (q) signalling events
Reactome : GPCR downstream signaling
Reactome : GPCR ligand binding
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Nucleotide-like (purinergic) receptors
Reactome : P2Y receptors
Reactome : Signal Transduction
Reactome : Signaling by GPCR
WikiPathway : GPCRs, Class A Rhodopsin-like
WikiPathway : Nucleotide GPCRs

Protein

HPRD : 16465

Clone

Cloning Information : 272261
HIP Master Clone ID : 202624
Original Clone ID : FLH272261.01L

Organism


TAX_ID : 9606
Species Specific ID: 10161

Genome

Chromosome : 13
Map Location : 13q14
Ensembl : ENSG00000139679