DNASU Plasmid Repository • 480.965.5697 | Email

PRKCD (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRKCD
Gene Name:  protein kinase C, delta
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000261.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000326

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2031nts         Open reading frame : 1 to 2031
Reference Sequence Alignment

ATGGCGCCGTTCCTGCGCATCGCCTTCAACTCCTATGAGCTGGGCTCCCTGCAGGCCGAG
GACGAGGCGAACCAGCCCTTCTGTGCCGTGAAGATGAAGGAGGCGCTCAGCACAGAGCGT
GGGAAAACACTGGTGCAGAAGAAGCCGACCATGTATCCTGAGTGGAAGTCGACGTTCGAT
GCCCACATCTATGAGGGGCGCGTCATCCAGATTGTGCTAATGCGGGCAGCAGAGGAGCCA
GTGTCTGAGGTGACCGTGGGTGTGTCGGTGCTGGCCGAGCGCTGCAAGAAGAACAATGGC
AAGGCTGAGTTCTGGCTGGACCTGCAGCCTCAGGCCAAGGTGTTGATGTCTGTTCAGTAT
TTCCTGGAGGACGTGGATTGCAAACAATCTATGCGCAGTGAGGACGAGGCCAAGTTCCCA
ACGATGAACCGCCGCGGAGCCATCAAACAGGCCAAAATCCACTACATCAAGAACCATGAG
TTTATCGCCACCTTCTTTGGGCAACCCACCTTCTGTTCTGTGTGCAAAGACTTTGTCTGG
GGCCTCAACAAGCAAGGCTACAAATGCAGGCAATGTAACGCTGCCATCCACAAGAAATGC
ATCGACAAGATCATCGGCAGATGCACTGGCACCGCGGCCAACAGCCGGGACACTATATTC
CAGAAAGAACGCTTCAACATCGACATGCCGCACCGCTTCAAGGTTCACAACTACATGAGC
CCCACCTTCTGTGACCACTGCGGCAGCCTGCTCTGGGGACTGGTGAAGCAGGGATTAAAG
TGTGAAGACTGCGGCATGAATGTGCACCATAAATGCCGGGAGAAGGTGGCCAACCTCTGC
GGCATCAACCAGAAGCTTTTGGCTGAGGCCTTGAACCAAGTCACCCAGAGAGCCTCCCGG
AGATCAGACTCAGCCTCCTCAGAGCCTGTTGGGATATATCAGGGTTTCGAGAAGAAGACC
GGAGTTGCTGGGGAGGACATGCAAGACAACAGTGGGACCTACGGCAAGATCTGGGAGGGC
AGCAGCAAGTGCAACATCAACAACTTCATCTTCCACAAGGTCCTGGGCAAAGGCAGCTTC
GGGAAGGTGCTGCTTGGAGAGCTGAAGGGCAGAGGAGAGTACTCTGCCATCAAGGCCCTC
AAGAAGGATGTGGTCCTGATCGACGACGACGTGGAGTGCACCATGGTTGAGAAGCGGGTG
CTGACACTTGCCGCAGAGAATCCCTTTCTCACCCACCTCATCTGCACCTTCCAGACCAAG
GACCACCTGTTCTTTGTGATGGAGTTCCTCAACGGGGGGGACCTGATGTACCACATCCAG
GACAAAGGCCGCTTTGAACTCTACCGTGCCACGTTTTATGCCGCTGAGATAATGTGTGGA
CTGCAGTTTCTACACAGCAAGGGCATCATTTACAGGGACCTCAAACTGGACAATGTGCTG
TTGGACCGGGATGGCCACATCAAGATTGCCGACTTTGGGATGTGCAAAGAGAACATATTC
GGGGAGAGCCGGGCCAGCACCTTCTGCGGCACCCCTGACTATATCGCCCCTGAGATCCTA
CAGGGCCTGAAGTACACATTCTCTGTGGACTGGTGGTCTTTCGGGGTCCTTCTGTACGAG
ATGCTCATTGGCCAGTCCCCCTTCCATGGTGATGATGAGGATGAACTCTTCGAGTCCATC
CGTGTGGACACGCCACATTATCCCCGCTGGATCACCAAGGAGTCCAAGGACATCCTGGAG
AAGCTCTTTGAAAGGGAACCAACCAAGAGGCTGGGAATGACGGGAAACATCAAAATCCAC
CCCTTCTTCAAGACCATAAACTGGACTCTGCTGGAAAAGCGGAGGTTGGAGCCACCCTTC
AGGCCCAAAGTGAAGTCACCCAGAGACTACAGTAACTTTGACCAGGAGTTCCTGAACGAG
AAGGCGCGCCTCTCCTACAGCGACAAGAACCTCATCGACTCCATGGACCAGTCTGCATTC
GCTGGCTTCTCCTTTGTGAACCCCAAATTCGAGCACCTCCTGGAAGATTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2089
Start on reference sequence 59
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRKCD
Symbol Nomenclature : PRKCD
SYNONYM : CVID9; MAY1; PKCD; nPKC-delta
Designation : protein kinase C delta VIII|protein kinase C delta type|tyrosine-protein kinase PRKCD
Full Nomenclature : protein kinase C, delta
GENEID : 5580
GI : 33304012
GenBank Accession : AY335687
HGNC : 9399
MIM : 176977
Vega : OTTHUMG00000133659
Target GenBank: NM_006254

 

Reference Sequence Alignment

  

HsCD00000326      ATGGCGCCGTTCCTGCGCATCGCCTTCAACTCCTATGAGCTGGGCTCCCTGCAGGCCGAG
NM_006254.3       ATGGCGCCGTTCCTGCGCATCGCCTTCAACTCCTATGAGCTGGGCTCCCTGCAGGCCGAG
NM_212539.1       ATGGCGCCGTTCCTGCGCATCGCCTTCAACTCCTATGAGCTGGGCTCCCTGCAGGCCGAG
                  ************************************************************

HsCD00000326      GACGAGGCGAACCAGCCCTTCTGTGCCGTGAAGATGAAGGAGGCGCTCAGCACAGAGCGT
NM_006254.3       GACGAGGCGAACCAGCCCTTCTGTGCCGTGAAGATGAAGGAGGCGCTCAGCACAGAGCGT
NM_212539.1       GACGAGGCGAACCAGCCCTTCTGTGCCGTGAAGATGAAGGAGGCGCTCAGCACAGAGCGT
                  ************************************************************

HsCD00000326      GGGAAAACACTGGTGCAGAAGAAGCCGACCATGTATCCTGAGTGGAAGTCGACGTTCGAT
NM_006254.3       GGGAAAACACTGGTGCAGAAGAAGCCGACCATGTATCCTGAGTGGAAGTCGACGTTCGAT
NM_212539.1       GGGAAAACACTGGTGCAGAAGAAGCCGACCATGTATCCTGAGTGGAAGTCGACGTTCGAT
                  ************************************************************

HsCD00000326      GCCCACATCTATGAGGGGCGCGTCATCCAGATTGTGCTAATGCGGGCAGCAGAGGAGCCA
NM_006254.3       GCCCACATCTATGAGGGGCGCGTCATCCAGATTGTGCTAATGCGGGCAGCAGAGGAGCCA
NM_212539.1       GCCCACATCTATGAGGGGCGCGTCATCCAGATTGTGCTAATGCGGGCAGCAGAGGAGCCA
                  ************************************************************

HsCD00000326      GTGTCTGAGGTGACCGTGGGTGTGTCGGTGCTGGCCGAGCGCTGCAAGAAGAACAATGGC
NM_006254.3       GTGTCTGAGGTGACCGTGGGTGTGTCGGTGCTGGCCGAGCGCTGCAAGAAGAACAATGGC
NM_212539.1       GTGTCTGAGGTGACCGTGGGTGTGTCGGTGCTGGCCGAGCGCTGCAAGAAGAACAATGGC
                  ************************************************************

HsCD00000326      AAGGCTGAGTTCTGGCTGGACCTGCAGCCTCAGGCCAAGGTGTTGATGTCTGTTCAGTAT
NM_006254.3       AAGGCTGAGTTCTGGCTGGACCTGCAGCCTCAGGCCAAGGTGTTGATGTCTGTTCAGTAT
NM_212539.1       AAGGCTGAGTTCTGGCTGGACCTGCAGCCTCAGGCCAAGGTGTTGATGTCTGTTCAGTAT
                  ************************************************************

HsCD00000326      TTCCTGGAGGACGTGGATTGCAAACAATCTATGCGCAGTGAGGACGAGGCCAAGTTCCCA
NM_006254.3       TTCCTGGAGGACGTGGATTGCAAACAGTCTATGCGCAGTGAGGACGAGGCCAAGTTCCCA
NM_212539.1       TTCCTGGAGGACGTGGATTGCAAACAGTCTATGCGCAGTGAGGACGAGGCCAAGTTCCCA
                  **************************.*********************************

HsCD00000326      ACGATGAACCGCCGCGGAGCCATCAAACAGGCCAAAATCCACTACATCAAGAACCATGAG
NM_006254.3       ACGATGAACCGCCGCGGAGCCATCAAACAGGCCAAAATCCACTACATCAAGAACCATGAG
NM_212539.1       ACGATGAACCGCCGCGGAGCCATCAAACAGGCCAAAATCCACTACATCAAGAACCATGAG
                  ************************************************************

HsCD00000326      TTTATCGCCACCTTCTTTGGGCAACCCACCTTCTGTTCTGTGTGCAAAGACTTTGTCTGG
NM_006254.3       TTTATCGCCACCTTCTTTGGGCAACCCACCTTCTGTTCTGTGTGCAAAGACTTTGTCTGG
NM_212539.1       TTTATCGCCACCTTCTTTGGGCAACCCACCTTCTGTTCTGTGTGCAAAGACTTTGTCTGG
                  ************************************************************

HsCD00000326      GGCCTCAACAAGCAAGGCTACAAATGCAGGCAATGTAACGCTGCCATCCACAAGAAATGC
NM_006254.3       GGCCTCAACAAGCAAGGCTACAAATGCAGGCAATGTAACGCTGCCATCCACAAGAAATGC
NM_212539.1       GGCCTCAACAAGCAAGGCTACAAATGCAGGCAATGTAACGCTGCCATCCACAAGAAATGC
                  ************************************************************

HsCD00000326      ATCGACAAGATCATCGGCAGATGCACTGGCACCGCGGCCAACAGCCGGGACACTATATTC
NM_006254.3       ATCGACAAGATCATCGGCAGATGCACTGGCACCGCGGCCAACAGCCGGGACACTATATTC
NM_212539.1       ATCGACAAGATCATCGGCAGATGCACTGGCACCGCGGCCAACAGCCGGGACACTATATTC
                  ************************************************************

HsCD00000326      CAGAAAGAACGCTTCAACATCGACATGCCGCACCGCTTCAAGGTTCACAACTACATGAGC
NM_006254.3       CAGAAAGAACGCTTCAACATCGACATGCCGCACCGCTTCAAGGTTCACAACTACATGAGC
NM_212539.1       CAGAAAGAACGCTTCAACATCGACATGCCGCACCGCTTCAAGGTTCACAACTACATGAGC
                  ************************************************************

HsCD00000326      CCCACCTTCTGTGACCACTGCGGCAGCCTGCTCTGGGGACTGGTGAAGCAGGGATTAAAG
NM_006254.3       CCCACCTTCTGTGACCACTGCGGCAGCCTGCTCTGGGGACTGGTGAAGCAGGGATTAAAG
NM_212539.1       CCCACCTTCTGTGACCACTGCGGCAGCCTGCTCTGGGGACTGGTGAAGCAGGGATTAAAG
                  ************************************************************

HsCD00000326      TGTGAAGACTGCGGCATGAATGTGCACCATAAATGCCGGGAGAAGGTGGCCAACCTCTGC
NM_006254.3       TGTGAAGACTGCGGCATGAATGTGCACCATAAATGCCGGGAGAAGGTGGCCAACCTCTGC
NM_212539.1       TGTGAAGACTGCGGCATGAATGTGCACCATAAATGCCGGGAGAAGGTGGCCAACCTCTGC
                  ************************************************************

HsCD00000326      GGCATCAACCAGAAGCTTTTGGCTGAGGCCTTGAACCAAGTCACCCAGAGAGCCTCCCGG
NM_006254.3       GGCATCAACCAGAAGCTTTTGGCTGAGGCCTTGAACCAAGTCACCCAGAGAGCCTCCCGG
NM_212539.1       GGCATCAACCAGAAGCTTTTGGCTGAGGCCTTGAACCAAGTCACCCAGAGAGCCTCCCGG
                  ************************************************************

HsCD00000326      AGATCAGACTCAGCCTCCTCAGAGCCTGTTGGGATATATCAGGGTTTCGAGAAGAAGACC
NM_006254.3       AGATCAGACTCAGCCTCCTCAGAGCCTGTTGGGATATATCAGGGTTTCGAGAAGAAGACC
NM_212539.1       AGATCAGACTCAGCCTCCTCAGAGCCTGTTGGGATATATCAGGGTTTCGAGAAGAAGACC
                  ************************************************************

HsCD00000326      GGAGTTGCTGGGGAGGACATGCAAGACAACAGTGGGACCTACGGCAAGATCTGGGAGGGC
NM_006254.3       GGAGTTGCTGGGGAGGACATGCAAGACAACAGTGGGACCTACGGCAAGATCTGGGAGGGC
NM_212539.1       GGAGTTGCTGGGGAGGACATGCAAGACAACAGTGGGACCTACGGCAAGATCTGGGAGGGC
                  ************************************************************

HsCD00000326      AGCAGCAAGTGCAACATCAACAACTTCATCTTCCACAAGGTCCTGGGCAAAGGCAGCTTC
NM_006254.3       AGCAGCAAGTGCAACATCAACAACTTCATCTTCCACAAGGTCCTGGGCAAAGGCAGCTTC
NM_212539.1       AGCAGCAAGTGCAACATCAACAACTTCATCTTCCACAAGGTCCTGGGCAAAGGCAGCTTC
                  ************************************************************

HsCD00000326      GGGAAGGTGCTGCTTGGAGAGCTGAAGGGCAGAGGAGAGTACTCTGCCATCAAGGCCCTC
NM_006254.3       GGGAAGGTGCTGCTTGGAGAGCTGAAGGGCAGAGGAGAGTACTTTGCCATCAAGGCCCTC
NM_212539.1       GGGAAGGTGCTGCTTGGAGAGCTGAAGGGCAGAGGAGAGTACTTTGCCATCAAGGCCCTC
                  ******************************************* ****************

HsCD00000326      AAGAAGGATGTGGTCCTGATCGACGACGACGTGGAGTGCACCATGGTTGAGAAGCGGGTG
NM_006254.3       AAGAAGGATGTGGTCCTGATCGACGACGACGTGGAGTGCACCATGGTTGAGAAGCGGGTG
NM_212539.1       AAGAAGGATGTGGTCCTGATCGACGACGACGTGGAGTGCACCATGGTTGAGAAGCGGGTG
                  ************************************************************

HsCD00000326      CTGACACTTGCCGCAGAGAATCCCTTTCTCACCCACCTCATCTGCACCTTCCAGACCAAG
NM_006254.3       CTGACACTTGCCGCAGAGAATCCCTTTCTCACCCACCTCATCTGCACCTTCCAGACCAAG
NM_212539.1       CTGACACTTGCCGCAGAGAATCCCTTTCTCACCCACCTCATCTGCACCTTCCAGACCAAG
                  ************************************************************

HsCD00000326      GACCACCTGTTCTTTGTGATGGAGTTCCTCAACGGGGGGGACCTGATGTACCACATCCAG
NM_006254.3       GACCACCTGTTCTTTGTGATGGAGTTCCTCAACGGGGGGGACCTGATGTACCACATCCAG
NM_212539.1       GACCACCTGTTCTTTGTGATGGAGTTCCTCAACGGGGGGGACCTGATGTACCACATCCAG
                  ************************************************************

HsCD00000326      GACAAAGGCCGCTTTGAACTCTACCGTGCCACGTTTTATGCCGCTGAGATAATGTGTGGA
NM_006254.3       GACAAAGGCCGCTTTGAACTCTACCGTGCCACGTTTTATGCCGCTGAGATAATGTGTGGA
NM_212539.1       GACAAAGGCCGCTTTGAACTCTACCGTGCCACGTTTTATGCCGCTGAGATAATGTGTGGA
                  ************************************************************

HsCD00000326      CTGCAGTTTCTACACAGCAAGGGCATCATTTACAGGGACCTCAAACTGGACAATGTGCTG
NM_006254.3       CTGCAGTTTCTACACAGCAAGGGCATCATTTACAGGGACCTCAAACTGGACAATGTGCTG
NM_212539.1       CTGCAGTTTCTACACAGCAAGGGCATCATTTACAGGGACCTCAAACTGGACAATGTGCTG
                  ************************************************************

HsCD00000326      TTGGACCGGGATGGCCACATCAAGATTGCCGACTTTGGGATGTGCAAAGAGAACATATTC
NM_006254.3       CTGGACCGGGATGGCCACATCAAGATTGCCGACTTTGGGATGTGCAAAGAGAACATATTC
NM_212539.1       CTGGACCGGGATGGCCACATCAAGATTGCCGACTTTGGGATGTGCAAAGAGAACATATTC
                   ***********************************************************

HsCD00000326      GGGGAGAGCCGGGCCAGCACCTTCTGCGGCACCCCTGACTATATCGCCCCTGAGATCCTA
NM_006254.3       GGGGAGAGCCGGGCCAGCACCTTCTGCGGCACCCCTGACTATATCGCCCCTGAGATCCTA
NM_212539.1       GGGGAGAGCCGGGCCAGCACCTTCTGCGGCACCCCTGACTATATCGCCCCTGAGATCCTA
                  ************************************************************

HsCD00000326      CAGGGCCTGAAGTACACATTCTCTGTGGACTGGTGGTCTTTCGGGGTCCTTCTGTACGAG
NM_006254.3       CAGGGCCTGAAGTACACATTCTCTGTGGACTGGTGGTCTTTCGGGGTCCTTCTGTACGAG
NM_212539.1       CAGGGCCTGAAGTACACATTCTCTGTGGACTGGTGGTCTTTCGGGGTCCTTCTGTACGAG
                  ************************************************************

HsCD00000326      ATGCTCATTGGCCAGTCCCCCTTCCATGGTGATGATGAGGATGAACTCTTCGAGTCCATC
NM_006254.3       ATGCTCATTGGCCAGTCCCCCTTCCATGGTGATGATGAGGATGAACTCTTCGAGTCCATC
NM_212539.1       ATGCTCATTGGCCAGTCCCCCTTCCATGGTGATGATGAGGATGAACTCTTCGAGTCCATC
                  ************************************************************

HsCD00000326      CGTGTGGACACGCCACATTATCCCCGCTGGATCACCAAGGAGTCCAAGGACATCCTGGAG
NM_006254.3       CGTGTGGACACGCCACATTATCCCCGCTGGATCACCAAGGAGTCCAAGGACATCCTGGAG
NM_212539.1       CGTGTGGACACGCCACATTATCCCCGCTGGATCACCAAGGAGTCCAAGGACATCCTGGAG
                  ************************************************************

HsCD00000326      AAGCTCTTTGAAAGGGAACCAACCAAGAGGCTGGGAATGACGGGAAACATCAAAATCCAC
NM_006254.3       AAGCTCTTTGAAAGGGAACCAACCAAGAGGCTGGGAGTGACCGGAAACATCAAAATCCAC
NM_212539.1       AAGCTCTTTGAAAGGGAACCAACCAAGAGGCTGGGAGTGACCGGAAACATCAAAATCCAC
                  ************************************.**** ******************

HsCD00000326      CCCTTCTTCAAGACCATAAACTGGACTCTGCTGGAAAAGCGGAGGTTGGAGCCACCCTTC
NM_006254.3       CCCTTCTTCAAGACCATAAACTGGACTCTGCTGGAAAAGCGGAGGTTGGAGCCACCTTTC
NM_212539.1       CCCTTCTTCAAGACCATAAACTGGACTCTGCTGGAAAAGCGGAGGTTGGAGCCACCTTTC
                  ******************************************************** ***

HsCD00000326      AGGCCCAAAGTGAAGTCACCCAGAGACTACAGTAACTTTGACCAGGAGTTCCTGAACGAG
NM_006254.3       AGGCCCAAAGTGAAGTCACCCAGAGACTACAGTAACTTTGACCAGGAGTTCCTGAACGAG
NM_212539.1       AGGCCCAAAGTGAAGTCACCCAGAGACTACAGTAACTTTGACCAGGAGTTCCTGAACGAG
                  ************************************************************

HsCD00000326      AAGGCGCGCCTCTCCTACAGCGACAAGAACCTCATCGACTCCATGGACCAGTCTGCATTC
NM_006254.3       AAGGCGCGCCTCTCCTACAGCGACAAGAACCTCATCGACTCCATGGACCAGTCTGCATTC
NM_212539.1       AAGGCGCGCCTCTCCTACAGCGACAAGAACCTCATCGACTCCATGGACCAGTCTGCATTC
                  ************************************************************

HsCD00000326      GCTGGCTTCTCCTTTGTGAACCCCAAATTCGAGCACCTCCTGGAAGATTTG
NM_006254.3       GCTGGCTTCTCCTTTGTGAACCCCAAATTCGAGCACCTCCTGGAAGATTGA
NM_212539.1       GCTGGCTTCTCCTTTGTGAACCCCAAATTCGAGCACCTCCTGGAAGATTGA
                  ************************************************* .

Pathways

NCI : Alpha-synuclein signaling
NCI : Ceramide signaling pathway
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : IFN-gamma pathway
NCI : IGF1 pathway
NCI : IL6-mediated signaling events
NCI : LPA receptor mediated events
NCI : PAR1-mediated thrombin signaling events
NCI : PDGFR-beta signaling pathway
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Syndecan-2-mediated signaling events
NCI : Syndecan-4-mediated signaling events
NCI : Thromboxane A2 receptor signaling
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : Validated transcriptional targets of TAp63 isoforms
NCI : p53 pathway
Panther : 5HT2 type receptor mediated signaling pathway
Panther : Alpha adrenergic receptor signaling pathway
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Panther : Histamine H1 receptor mediated signaling pathway
Panther : Muscarinic acetylcholine receptor 1 and 3 signaling pathway
Panther : Oxytocin receptor mediated signaling pathway
Panther : Thyrotropin-releasing hormone receptor signaling pathway
Panther : VEGF signaling pathway
Panther : Wnt signaling pathway
Reactome : Apoptosis
Reactome : Apoptotic cleavage of cellular proteins
Reactome : Apoptotic execution phase
Reactome : Ca-dependent events
Reactome : CaM pathway
Reactome : Calmodulin induced events
Reactome : Cytokine Signaling in Immune system
Reactome : DAG and IP3 signaling
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : Effects of PIP2 hydrolysis
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : G alpha (q) signalling events
Reactome : G alpha (z) signalling events
Reactome : G-protein mediated events
Reactome : GPCR downstream signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Gene Expression
Reactome : Hemostasis
Reactome : HuR stabilizes mRNA
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interferon Signaling
Reactome : Interferon gamma signaling
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Opioid Signalling
Reactome : PLC beta mediated events
Reactome : PLC-gamma1 signalling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Role of phospholipids in phagocytosis
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signalling by NGF
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : G Protein Signaling Pathways
WikiPathway : IL-6 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : MAPK signaling pathway
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : TCR Signaling Pathway
WikiPathway : Type II diabetes mellitus
WikiPathway : Type II interferon signaling (IFNG)
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency
WikiPathway : miRs in Muscle Cell Differentiation

Clone

Cloning Information : 261
HIP Master Clone ID : 87307
Original Clone ID : FLH000261.01L

Organism


TAX_ID : 9606
Species Specific ID: 5580

Genome

Chromosome : 3
Map Location : 3p21.31
Ensembl : ENSG00000163932

Reagents

Labome : PKC-delta-antibody