DNASU Plasmid Repository • 480.965.5697 | Email

RB1 (Homo sapiens) in pLenti6.2/V5-DEST (V5-tagged lentiviral mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RB1
Gene Name:  retinoblastoma 1
Sequence             
Original Clone ID: FLH269164.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.2/V5-DEST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00329429

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2787nts         Open reading frame : 1 to 2787
Reference Sequence Alignment

ATGCCGCCCAAAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGGAACCC
CCGGCACCGCCGCCGCCGCCCCCTCCTGAGGAGGACCCAGAGCAGGACAGCGGCCCGGAG
GACCTGCCTCTCGTCAGGCTTGAGTTTGAAGAAACAGAAGAACCTGATTTTACTGCATTA
TGTCAGAAATTAAAGATACCAGATCATGTCAGAGAGAGAGCTTGGTTAACTTGGGAGAAA
GTTTCATCTGTGGATGGAGTATTGGGAGGTTATATTCAAAAGAAAAAGGAACTGTGGGGA
ATCTGTATCTTTATTGCAGCAGTTGACCTAGATGAGATGTCGTTCACTTTTACTGAGCTA
CAGAAAAACATAGAAATCAGTGTCCATAAATTCTTTAACTTACTAAAAGAAATTGATACC
AGTACCAAAGTTGATAATGCTATGTCAAGACTGTTGAAGAAGTATGATGTATTGTTTGCA
CTCTTCAGCAAATTGGAAAGGACATGTGAACTTATATATTTGACACAACCCAGCAGTTCG
ATATCTACTGAAATAAATTCTGCATTGGTGCTAAAAGTTTCTTGGATCACATTTTTATTA
GCTAAAGGGGAAGTATTACAAATGGAAGATGATCTGGTGATTTCATTTCAGTTAATGCTA
TGTGTCCTTGACTATTTTATTAAACTCTCACCTCCCATGTTGCTCAAAGAACCATATAAA
ACAGCTGTTATACCCATTAATGGTTCACCTCGAACACCCAGGCGAGGTCAGAACAGGAGT
GCACGGATAGCAAAACAACTAGAAAATGATACAAGAATTATTGAAGTTCTCTGTAAAGAA
CATGAATGTAATATAGATGAGGTGAAAAATGTTTATTTCAAAAATTTTATACCTTTTATG
AATTCTCTTGGACTTGTAACATCTAATGGACTTCCAGAGGTTGAAAATCTTTCTAAACGA
TACGAAGAAATTTATCTTAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGAT
AAAACTCTTCAGACTGATTCTATAGACAGTTTTGAAACACAGAGAACACCACGAAAAAGT
AACCTTGATGAAGAGGTGAATGTAATTCCTCCACACACTCCAGTTAGGACTGTTATGAAC
ACTATCCAACAATTAATGATGATTTTAAATTCAGCAAGTGATCAACCTTCAGAAAATCTG
ATTTCCTATTTTAACAACTGCACAGTGAATCCAAAAGAAAGTATACTGAAAAGAGTGAAG
GATATAGGATACATCTTTAAAGAGAAATTTGCTAAAGCTGTGGGACAGGGTTGTGTCGAA
ATTGGATCACAGCGATACAAACTTGGAGTTCGCTTGTATTACCGAGTAATGGAATCCATG
CTTAAATCAGAAGAAGAACGATTATCCATTCAAAATTTTAGCAAACTTCTGAATGACAAC
ATTTTTCATATGTCTTTATTGGCGTGCGCTCTTGAGGTTGTAATGGCCACATATAGCAGA
AGTACATCTCAGAATCTTGATTCTGGAACAGATTTGTCTTTCCCATGGATTCTGAATGTG
CTTAATTTAAAAGCCTTTGATTTTTACAAAGTGATCGAAAGTTTTATCAAAGCAGAAGGC
AACTTGACAAGAGAAATGATAAAACATTTAGAACGATGTGAACATCGAATCATGGAATCC
CTTGCATGGCTCTCAGATTCACCTTTATTTGATCTTATTAAACAATCAAAGGACCGAGAA
GGACCAACTGATCACCTTGAATCTGCTTGTCCTCTTAATCTTCCTCTCCAGAATAATCAC
ACTGCAGCAGATATGTATCTTTCTCCTGTAAGATCTCCAAAGAAAAAAGGTTCAACTACG
CGTGTAAATTCTACTGCAAATGCAGAGACACAAGCAACCTCAGCCTTCCAGACCCAGAAG
CCATTGAAATCTACCTCTCTTTCACTGTTTTATAAAAAAGTGTATCGGCTAGCCTATCTC
CGGCTAAATACACTTTGTGAACGCCTTCTGTCTGAGCACCCAGAATTAGAACATATCATC
TGGACCCTTTTCCAGCACACCCTGCAGAATGAGTATGAACTCATGAGAGACAGGCATTTG
GACCAAATTATGATGTGTTCCATGTATGGCATATGCAAAGTGAAGAATATAGACCTTAAA
TTCAAAATCATTGTAACAGCATACAAGGATCTTCCTCATGCTGTTCAGGAGACATTCAAA
CGTGTTTTGATCAAAGAAGAGGAGTATGATTCTATTATAGTATTCTATAACTCGGTCTTC
ATGCAGAGACTGAAAACAAATATTTTGCAGTATGCTTCCACCAGGCCCCCTACCTTGTCA
CCAATACCTCACATTCCTCGAAGCCCTTACAAGTTTCCTAGTTCACCCTTACGGATTCCT
GGAGGGAACATCTATATTTCACCCCTGAAGAGTCCATATAAAATTTCAGAAGGTCTGCCA
ACACCAACAAAAATGACTCCAAGATCAAGAATCTTAGTATCAATTGGTGAATCATTCGGG
ACTTCTGAGAAGTTCCAGAAAATAAATCAGATGGTATGTAACAGCGACCGTGTGCTCAAA
AGAAGTGCTGAAGGAAGCAACCCTCCTAAACCACTGAAAAAACTACGCTTTGATATTGAA
GGATCAGATGAAGCAGATGGAAGTAAACATCTCCCAGGAGAGTCCAAATTTCAGCAGAAA
CTGGCAGAAATGACTTCTACTCGAACACGAATGCAAAAGCAGAAAATGAATGATAGCATG
GATACCTCAAACAAGGAAGAGAAATTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 2939
Start on reference sequence 153
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.2/V5-DEST

pLenti6.2V5-DEST in advanced viewed

Synonyms: pLenti6.2/V5-DEST
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: Lentiviral mammalian expression vector;CMV promoter and C-terminal V5 tag; ampicillin resistance in bacteria; blasticidin resistance in mammalian cells; Gateway recombinational cloning.
Comments: None
Size (bp): 8813
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 7733 8406
death cassette ccdB ccdB death cassette (removed when insert is present) 3767 3976
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
poly-A signal SV40 SV40 polyadenylation signal 5639 5770
promoter RSV RSV/5' LTR hybrid promoter 1 410
promoter CMV CMV promoter driving gene of interest 1809 2392
promoter PGK PGK promoter to drive selection marker in mammalian cells 4266 4771
recombination site attR2 attR2 recombinational cloning site 4127 4142
recombination site attR1 attR1 recombinational cloning site 2440 2456
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
selectable marker AmpR Ampicillin resistance gene for selection in bacteria 6728 7588
selectable marker BlastR Blasticidin resistance gene in mammalian cells 4849 5249
selectable marker CmR chloramphenicol resistance marker (removed in plasmids with insert) 2673 3329
splice acceptor site 3' splice acceptor two 3' splice acceptors at 1656 and 1684 1656 1656
splice donor site 5' splice donor 5' splice donor 520 520
tag V5 C-terminal V5 epitope tag 4197 4238

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RB1
Symbol Nomenclature : RB1
SYNONYM : OSRC; RB; p105-Rb; pRb; pp110
Designation : prepro-retinoblastoma-associated protein|retinoblastoma suspectibility protein|retinoblastoma-associated protein
Full Nomenclature : retinoblastoma 1
GENEID : 5925
Locus Tag : RP11-174I10.1
HGNC : 9884
MIM : 614041
Vega : OTTHUMG00000016900
Target GenBank: BC039060

 

Reference Sequence Alignment

  

HsCD00329429      ATGCCGCCCAAAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGGAACCC
NM_000321.2       ATGCCGCCCAAAACCCCCCGAAAAACGGCCGCCACCGCCGCCGCTGCCGCCGCGGAACCC
                  ************************************************************

HsCD00329429      CCGGCACCGCCGCCGCCGCCCCCTCCTGAGGAGGACCCAGAGCAGGACAGCGGCCCGGAG
NM_000321.2       CCGGCACCGCCGCCGCCGCCCCCTCCTGAGGAGGACCCAGAGCAGGACAGCGGCCCGGAG
                  ************************************************************

HsCD00329429      GACCTGCCTCTCGTCAGGCTTGAGTTTGAAGAAACAGAAGAACCTGATTTTACTGCATTA
NM_000321.2       GACCTGCCTCTCGTCAGGCTTGAGTTTGAAGAAACAGAAGAACCTGATTTTACTGCATTA
                  ************************************************************

HsCD00329429      TGTCAGAAATTAAAGATACCAGATCATGTCAGAGAGAGAGCTTGGTTAACTTGGGAGAAA
NM_000321.2       TGTCAGAAATTAAAGATACCAGATCATGTCAGAGAGAGAGCTTGGTTAACTTGGGAGAAA
                  ************************************************************

HsCD00329429      GTTTCATCTGTGGATGGAGTATTGGGAGGTTATATTCAAAAGAAAAAGGAACTGTGGGGA
NM_000321.2       GTTTCATCTGTGGATGGAGTATTGGGAGGTTATATTCAAAAGAAAAAGGAACTGTGGGGA
                  ************************************************************

HsCD00329429      ATCTGTATCTTTATTGCAGCAGTTGACCTAGATGAGATGTCGTTCACTTTTACTGAGCTA
NM_000321.2       ATCTGTATCTTTATTGCAGCAGTTGACCTAGATGAGATGTCGTTCACTTTTACTGAGCTA
                  ************************************************************

HsCD00329429      CAGAAAAACATAGAAATCAGTGTCCATAAATTCTTTAACTTACTAAAAGAAATTGATACC
NM_000321.2       CAGAAAAACATAGAAATCAGTGTCCATAAATTCTTTAACTTACTAAAAGAAATTGATACC
                  ************************************************************

HsCD00329429      AGTACCAAAGTTGATAATGCTATGTCAAGACTGTTGAAGAAGTATGATGTATTGTTTGCA
NM_000321.2       AGTACCAAAGTTGATAATGCTATGTCAAGACTGTTGAAGAAGTATGATGTATTGTTTGCA
                  ************************************************************

HsCD00329429      CTCTTCAGCAAATTGGAAAGGACATGTGAACTTATATATTTGACACAACCCAGCAGTTCG
NM_000321.2       CTCTTCAGCAAATTGGAAAGGACATGTGAACTTATATATTTGACACAACCCAGCAGTTCG
                  ************************************************************

HsCD00329429      ATATCTACTGAAATAAATTCTGCATTGGTGCTAAAAGTTTCTTGGATCACATTTTTATTA
NM_000321.2       ATATCTACTGAAATAAATTCTGCATTGGTGCTAAAAGTTTCTTGGATCACATTTTTATTA
                  ************************************************************

HsCD00329429      GCTAAAGGGGAAGTATTACAAATGGAAGATGATCTGGTGATTTCATTTCAGTTAATGCTA
NM_000321.2       GCTAAAGGGGAAGTATTACAAATGGAAGATGATCTGGTGATTTCATTTCAGTTAATGCTA
                  ************************************************************

HsCD00329429      TGTGTCCTTGACTATTTTATTAAACTCTCACCTCCCATGTTGCTCAAAGAACCATATAAA
NM_000321.2       TGTGTCCTTGACTATTTTATTAAACTCTCACCTCCCATGTTGCTCAAAGAACCATATAAA
                  ************************************************************

HsCD00329429      ACAGCTGTTATACCCATTAATGGTTCACCTCGAACACCCAGGCGAGGTCAGAACAGGAGT
NM_000321.2       ACAGCTGTTATACCCATTAATGGTTCACCTCGAACACCCAGGCGAGGTCAGAACAGGAGT
                  ************************************************************

HsCD00329429      GCACGGATAGCAAAACAACTAGAAAATGATACAAGAATTATTGAAGTTCTCTGTAAAGAA
NM_000321.2       GCACGGATAGCAAAACAACTAGAAAATGATACAAGAATTATTGAAGTTCTCTGTAAAGAA
                  ************************************************************

HsCD00329429      CATGAATGTAATATAGATGAGGTGAAAAATGTTTATTTCAAAAATTTTATACCTTTTATG
NM_000321.2       CATGAATGTAATATAGATGAGGTGAAAAATGTTTATTTCAAAAATTTTATACCTTTTATG
                  ************************************************************

HsCD00329429      AATTCTCTTGGACTTGTAACATCTAATGGACTTCCAGAGGTTGAAAATCTTTCTAAACGA
NM_000321.2       AATTCTCTTGGACTTGTAACATCTAATGGACTTCCAGAGGTTGAAAATCTTTCTAAACGA
                  ************************************************************

HsCD00329429      TACGAAGAAATTTATCTTAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGAT
NM_000321.2       TACGAAGAAATTTATCTTAAAAATAAAGATCTAGATGCAAGATTATTTTTGGATCATGAT
                  ************************************************************

HsCD00329429      AAAACTCTTCAGACTGATTCTATAGACAGTTTTGAAACACAGAGAACACCACGAAAAAGT
NM_000321.2       AAAACTCTTCAGACTGATTCTATAGACAGTTTTGAAACACAGAGAACACCACGAAAAAGT
                  ************************************************************

HsCD00329429      AACCTTGATGAAGAGGTGAATGTAATTCCTCCACACACTCCAGTTAGGACTGTTATGAAC
NM_000321.2       AACCTTGATGAAGAGGTGAATGTAATTCCTCCACACACTCCAGTTAGGACTGTTATGAAC
                  ************************************************************

HsCD00329429      ACTATCCAACAATTAATGATGATTTTAAATTCAGCAAGTGATCAACCTTCAGAAAATCTG
NM_000321.2       ACTATCCAACAATTAATGATGATTTTAAATTCAGCAAGTGATCAACCTTCAGAAAATCTG
                  ************************************************************

HsCD00329429      ATTTCCTATTTTAACAACTGCACAGTGAATCCAAAAGAAAGTATACTGAAAAGAGTGAAG
NM_000321.2       ATTTCCTATTTTAACAACTGCACAGTGAATCCAAAAGAAAGTATACTGAAAAGAGTGAAG
                  ************************************************************

HsCD00329429      GATATAGGATACATCTTTAAAGAGAAATTTGCTAAAGCTGTGGGACAGGGTTGTGTCGAA
NM_000321.2       GATATAGGATACATCTTTAAAGAGAAATTTGCTAAAGCTGTGGGACAGGGTTGTGTCGAA
                  ************************************************************

HsCD00329429      ATTGGATCACAGCGATACAAACTTGGAGTTCGCTTGTATTACCGAGTAATGGAATCCATG
NM_000321.2       ATTGGATCACAGCGATACAAACTTGGAGTTCGCTTGTATTACCGAGTAATGGAATCCATG
                  ************************************************************

HsCD00329429      CTTAAATCAGAAGAAGAACGATTATCCATTCAAAATTTTAGCAAACTTCTGAATGACAAC
NM_000321.2       CTTAAATCAGAAGAAGAACGATTATCCATTCAAAATTTTAGCAAACTTCTGAATGACAAC
                  ************************************************************

HsCD00329429      ATTTTTCATATGTCTTTATTGGCGTGCGCTCTTGAGGTTGTAATGGCCACATATAGCAGA
NM_000321.2       ATTTTTCATATGTCTTTATTGGCGTGCGCTCTTGAGGTTGTAATGGCCACATATAGCAGA
                  ************************************************************

HsCD00329429      AGTACATCTCAGAATCTTGATTCTGGAACAGATTTGTCTTTCCCATGGATTCTGAATGTG
NM_000321.2       AGTACATCTCAGAATCTTGATTCTGGAACAGATTTGTCTTTCCCATGGATTCTGAATGTG
                  ************************************************************

HsCD00329429      CTTAATTTAAAAGCCTTTGATTTTTACAAAGTGATCGAAAGTTTTATCAAAGCAGAAGGC
NM_000321.2       CTTAATTTAAAAGCCTTTGATTTTTACAAAGTGATCGAAAGTTTTATCAAAGCAGAAGGC
                  ************************************************************

HsCD00329429      AACTTGACAAGAGAAATGATAAAACATTTAGAACGATGTGAACATCGAATCATGGAATCC
NM_000321.2       AACTTGACAAGAGAAATGATAAAACATTTAGAACGATGTGAACATCGAATCATGGAATCC
                  ************************************************************

HsCD00329429      CTTGCATGGCTCTCAGATTCACCTTTATTTGATCTTATTAAACAATCAAAGGACCGAGAA
NM_000321.2       CTTGCATGGCTCTCAGATTCACCTTTATTTGATCTTATTAAACAATCAAAGGACCGAGAA
                  ************************************************************

HsCD00329429      GGACCAACTGATCACCTTGAATCTGCTTGTCCTCTTAATCTTCCTCTCCAGAATAATCAC
NM_000321.2       GGACCAACTGATCACCTTGAATCTGCTTGTCCTCTTAATCTTCCTCTCCAGAATAATCAC
                  ************************************************************

HsCD00329429      ACTGCAGCAGATATGTATCTTTCTCCTGTAAGATCTCCAAAGAAAAAAGGTTCAACTACG
NM_000321.2       ACTGCAGCAGATATGTATCTTTCTCCTGTAAGATCTCCAAAGAAAAAAGGTTCAACTACG
                  ************************************************************

HsCD00329429      CGTGTAAATTCTACTGCAAATGCAGAGACACAAGCAACCTCAGCCTTCCAGACCCAGAAG
NM_000321.2       CGTGTAAATTCTACTGCAAATGCAGAGACACAAGCAACCTCAGCCTTCCAGACCCAGAAG
                  ************************************************************

HsCD00329429      CCATTGAAATCTACCTCTCTTTCACTGTTTTATAAAAAAGTGTATCGGCTAGCCTATCTC
NM_000321.2       CCATTGAAATCTACCTCTCTTTCACTGTTTTATAAAAAAGTGTATCGGCTAGCCTATCTC
                  ************************************************************

HsCD00329429      CGGCTAAATACACTTTGTGAACGCCTTCTGTCTGAGCACCCAGAATTAGAACATATCATC
NM_000321.2       CGGCTAAATACACTTTGTGAACGCCTTCTGTCTGAGCACCCAGAATTAGAACATATCATC
                  ************************************************************

HsCD00329429      TGGACCCTTTTCCAGCACACCCTGCAGAATGAGTATGAACTCATGAGAGACAGGCATTTG
NM_000321.2       TGGACCCTTTTCCAGCACACCCTGCAGAATGAGTATGAACTCATGAGAGACAGGCATTTG
                  ************************************************************

HsCD00329429      GACCAAATTATGATGTGTTCCATGTATGGCATATGCAAAGTGAAGAATATAGACCTTAAA
NM_000321.2       GACCAAATTATGATGTGTTCCATGTATGGCATATGCAAAGTGAAGAATATAGACCTTAAA
                  ************************************************************

HsCD00329429      TTCAAAATCATTGTAACAGCATACAAGGATCTTCCTCATGCTGTTCAGGAGACATTCAAA
NM_000321.2       TTCAAAATCATTGTAACAGCATACAAGGATCTTCCTCATGCTGTTCAGGAGACATTCAAA
                  ************************************************************

HsCD00329429      CGTGTTTTGATCAAAGAAGAGGAGTATGATTCTATTATAGTATTCTATAACTCGGTCTTC
NM_000321.2       CGTGTTTTGATCAAAGAAGAGGAGTATGATTCTATTATAGTATTCTATAACTCGGTCTTC
                  ************************************************************

HsCD00329429      ATGCAGAGACTGAAAACAAATATTTTGCAGTATGCTTCCACCAGGCCCCCTACCTTGTCA
NM_000321.2       ATGCAGAGACTGAAAACAAATATTTTGCAGTATGCTTCCACCAGGCCCCCTACCTTGTCA
                  ************************************************************

HsCD00329429      CCAATACCTCACATTCCTCGAAGCCCTTACAAGTTTCCTAGTTCACCCTTACGGATTCCT
NM_000321.2       CCAATACCTCACATTCCTCGAAGCCCTTACAAGTTTCCTAGTTCACCCTTACGGATTCCT
                  ************************************************************

HsCD00329429      GGAGGGAACATCTATATTTCACCCCTGAAGAGTCCATATAAAATTTCAGAAGGTCTGCCA
NM_000321.2       GGAGGGAACATCTATATTTCACCCCTGAAGAGTCCATATAAAATTTCAGAAGGTCTGCCA
                  ************************************************************

HsCD00329429      ACACCAACAAAAATGACTCCAAGATCAAGAATCTTAGTATCAATTGGTGAATCATTCGGG
NM_000321.2       ACACCAACAAAAATGACTCCAAGATCAAGAATCTTAGTATCAATTGGTGAATCATTCGGG
                  ************************************************************

HsCD00329429      ACTTCTGAGAAGTTCCAGAAAATAAATCAGATGGTATGTAACAGCGACCGTGTGCTCAAA
NM_000321.2       ACTTCTGAGAAGTTCCAGAAAATAAATCAGATGGTATGTAACAGCGACCGTGTGCTCAAA
                  ************************************************************

HsCD00329429      AGAAGTGCTGAAGGAAGCAACCCTCCTAAACCACTGAAAAAACTACGCTTTGATATTGAA
NM_000321.2       AGAAGTGCTGAAGGAAGCAACCCTCCTAAACCACTGAAAAAACTACGCTTTGATATTGAA
                  ************************************************************

HsCD00329429      GGATCAGATGAAGCAGATGGAAGTAAACATCTCCCAGGAGAGTCCAAATTTCAGCAGAAA
NM_000321.2       GGATCAGATGAAGCAGATGGAAGTAAACATCTCCCAGGAGAGTCCAAATTTCAGCAGAAA
                  ************************************************************

HsCD00329429      CTGGCAGAAATGACTTCTACTCGAACACGAATGCAAAAGCAGAAAATGAATGATAGCATG
NM_000321.2       CTGGCAGAAATGACTTCTACTCGAACACGAATGCAAAAGCAGAAAATGAATGATAGCATG
                  ************************************************************

HsCD00329429      GATACCTCAAACAAGGAAGAGAAATTG
NM_000321.2       GATACCTCAAACAAGGAAGAGAAATGA
                  ************************* .

Pathways

NCI : ATF-2 transcription factor network
NCI : Ceramide signaling pathway
NCI : Direct p53 effectors
NCI : E2F transcription factor network
NCI : FOXM1 transcription factor network
NCI : Notch-mediated HES/HEY network
NCI : Regulation of retinoblastoma protein
NCI : p73 transcription factor network
Panther : p53 pathway feedback loops 2
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Condensation of Prophase Chromosomes
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin D associated events in G1
Reactome : Cyclin E associated events during G1/S transition
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Replication
Reactome : E2F mediated regulation of DNA replication
Reactome : Formation of Senescence-Associated Heterochromatin Foci (SAHF)
Reactome : G1 Phase
Reactome : G1/S Transition
Reactome : Inhibition of replication initiation of damaged DNA by RB1/E2F1
Reactome : M Phase
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prophase
Reactome : Orc1 removal from chromatin
Reactome : Phosphorylation of proteins involved in G1/S transition by active Cyclin E:Cdk2 complexes
Reactome : Regulation of DNA replication
Reactome : Removal of licensing factors from origins
Reactome : S Phase
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
WikiPathway : Adipogenesis
WikiPathway : Androgen receptor signaling pathway
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : Epithelium TarBase
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : G1 to S cell cycle control
WikiPathway : ID signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Senescence and Autophagy
WikiPathway : TSH signaling pathway
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 269164
HIP Master Clone ID : 153244
Original Clone ID : FLH269164.01L

Organism


TAX_ID : 9606
Species Specific ID: 5925

Genome

Chromosome : 13
Map Location : 13q14.2
Ensembl : ENSG00000139687

Reagents

Labome : Rb-antibody