DNASU Plasmid Repository • 480.965.5697 | Email

CTNNB1 (Homo sapiens) in pLenti6.2/V5-DEST (V5-tagged lentiviral mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CTNNB1
Gene Name:  catenin (cadherin-associated protein), beta 1, 88kDa
Sequence             
Original Clone ID: FLH268186.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.2/V5-DEST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00329967

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2346nts         Open reading frame : 1 to 2346
Reference Sequence Alignment

ATGGCTACTCAAGCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCG
GCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTGCCACT
ACCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTCC
CAAGTCCTGTATGAGTGGGAACAGGGATTTTCTCAGTCCTTCACTCAAGAACAAGTAGCT
GATATTGATGGACAGTATGCAATGACTCGAGCTCAGAGGGTACGAGCTGCTATGTTCCCT
GAGACATTAGATGAGGGCATGCAGATCCCATCTACACAGTTTGATGCTGCTCATCCCACT
AATGTCCAGCGTTTGGCTGAACCATCACAGATGCTGAAACATGCAGTTGTAAACTTGATT
AACTATCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGACAAAACTGCTA
AATGACGAGGACCAGGTGGTGGTTAATAAGGCTGCAGTTATGGTCCATCAGCTTTCTAAA
AAGGAAGCTTCCAGACACGCTATCATGCGTTCTCCTCAGATGGTGTCTGCTATTGTACGT
ACCATGCAGAATACAAATGATGTAGAAACAGCTCGTTGTACCGCTGGGACCTTGCATAAC
CTTTCCCATCATCGTGAGGGCTTACTGGCCATCTTTAAGTCTGGAGGCATTCCTGCCCTG
GTGAAAATGCTTGGTTCACCAGTGGATTCTGTGTTGTTTTATGCCATTACAACTCTCCAC
AACCTTTTATTACATCAAGAAGGAGCTAAAATGGCAGTGCGTTTAGCTGGTGGGCTGCAG
AAAATGGTTGCCTTGCTCAACAAAACAAATGTTAAATTCTTGGCTATTACGACAGACTGC
CTTCAAATTTTAGCTTATGGCAACCAAGAAAGCAAGCTCATCATACTGGCTAGTGGTGGA
CCCCAAGCTTTAGTAAATATAATGAGGACCTATACTTACGAAAAACTACTGTGGACCACA
AGCAGAGTGCTGAAGGTGCTATCTGTCTGCTCTAGTAATAAGCCGGCTATTGTAGAAGCT
GGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAAC
TGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGT
CTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCA
GCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAA
GTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATC
ACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATG
GCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCA
CCATCCCACTGGCCTCTGATAAAGGCTACTGTTGGATTGATTCGAAATCTTGCCCTTTGT
CCCGCAAATCATGCACCTTTGCGTGAGCAGGGTGCCATTCCACGACTAGTTCAGTTGCTT
GTTCGTGCACATCAGGATACCCAGCGCCGTACGTCCATGGGTGGGACACAGCAGCAATTT
GTGGAGGGGGTCCGCATGGAAGAAATAGTTGAAGGTTGTACCGGAGCCCTTCACATCCTA
GCTCGGGATGTTCACAACCGAATTGTTATCAGAGGACTAAATACCATTCCATTGTTTGTG
CAGCTGCTTTATTCTCCCATTGAAAACATCCAAAGAGTAGCTGCAGGGGTCCTCTGTGAA
CTTGCTCAGGACAAGGAAGCTGCAGAAGCTATTGAAGCTGAGGGAGCCACAGCTCCTCTG
ACAGAGTTACTTCACTCTAGGAATGAAGGTGTGGCGACATATGCAGCTGCTGTTTTGTTC
CGAATGTCTGAGGACAAGCCACAAGATTACAAGAAACGGCTTTCAGTTGAGCTGACCAGC
TCTCTCTTCAGAACAGAGCCAATGGCTTGGAATGAGACTGCTGATCTTGGACTTGATATT
GGTGCCCAGGGAGAACCCCTTGGATATCGCCAGGATGATCCTAGCTATCGTTCTTTTCAC
TCTGGTGGATATGGCCAGGATGCCTTGGGTATGGACCCCATGATGGAACATGAGATGGGT
GGCCACCACCCTGGTGCTGACTATCCAGTTGATGGGCTGCCAGATCTGGGGCATGCCCAG
GACCTCATGGATGGGCTGCCTCCAGGTGACAGCAATCAGCTGGCCTGGTTTGATACTGAC
CTGTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 2556
Start on reference sequence 211
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.2/V5-DEST

pLenti6.2V5-DEST in advanced viewed

Synonyms: pLenti6.2/V5-DEST
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: Lentiviral mammalian expression vector;CMV promoter and C-terminal V5 tag; ampicillin resistance in bacteria; blasticidin resistance in mammalian cells; Gateway recombinational cloning.
Comments: None
Size (bp): 8813
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 7733 8406
death cassette ccdB ccdB death cassette (removed when insert is present) 3767 3976
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
poly-A signal SV40 SV40 polyadenylation signal 5639 5770
promoter RSV RSV/5' LTR hybrid promoter 1 410
promoter CMV CMV promoter driving gene of interest 1809 2392
promoter PGK PGK promoter to drive selection marker in mammalian cells 4266 4771
recombination site attR2 attR2 recombinational cloning site 4127 4142
recombination site attR1 attR1 recombinational cloning site 2440 2456
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
selectable marker AmpR Ampicillin resistance gene for selection in bacteria 6728 7588
selectable marker BlastR Blasticidin resistance gene in mammalian cells 4849 5249
selectable marker CmR chloramphenicol resistance marker (removed in plasmids with insert) 2673 3329
splice acceptor site 3' splice acceptor two 3' splice acceptors at 1656 and 1684 1656 1656
splice donor site 5' splice donor 5' splice donor 520 520
tag V5 C-terminal V5 epitope tag 4197 4238

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CTNNB1
Symbol Nomenclature : CTNNB1
SYNONYM : CTNNB; MRD19; armadillo
Designation : catenin beta-1
Full Nomenclature : catenin (cadherin-associated protein), beta 1, 88kDa
GENEID : 1499
Locus Tag : OK/SW-cl.35
HGNC : 2514
MIM : 116806
Vega : OTTHUMG00000131393
Target GenBank: BC058926

 

Reference Sequence Alignment

  

HsCD00329967        ATGGCTACTCAAGCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCG
NM_001098210.1      ATGGCTACTCAAGCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCG
NM_001904.3         ATGGCTACTCAAGCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCG
NM_001098209.1      ATGGCTACTCAAGCTGATTTGATGGAGTTGGACATGGCCATGGAACCAGACAGAAAAGCG
                    ************************************************************

HsCD00329967        GCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTGCCACT
NM_001098210.1      GCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTGCCACT
NM_001904.3         GCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTGCCACT
NM_001098209.1      GCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTGCCACT
                    ************************************************************

HsCD00329967        ACCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTCC
NM_001098210.1      ACCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTCC
NM_001904.3         ACCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTCC
NM_001098209.1      ACCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATGTGGATACCTCC
                    ************************************************************

HsCD00329967        CAAGTCCTGTATGAGTGGGAACAGGGATTTTCTCAGTCCTTCACTCAAGAACAAGTAGCT
NM_001098210.1      CAAGTCCTGTATGAGTGGGAACAGGGATTTTCTCAGTCCTTCACTCAAGAACAAGTAGCT
NM_001904.3         CAAGTCCTGTATGAGTGGGAACAGGGATTTTCTCAGTCCTTCACTCAAGAACAAGTAGCT
NM_001098209.1      CAAGTCCTGTATGAGTGGGAACAGGGATTTTCTCAGTCCTTCACTCAAGAACAAGTAGCT
                    ************************************************************

HsCD00329967        GATATTGATGGACAGTATGCAATGACTCGAGCTCAGAGGGTACGAGCTGCTATGTTCCCT
NM_001098210.1      GATATTGATGGACAGTATGCAATGACTCGAGCTCAGAGGGTACGAGCTGCTATGTTCCCT
NM_001904.3         GATATTGATGGACAGTATGCAATGACTCGAGCTCAGAGGGTACGAGCTGCTATGTTCCCT
NM_001098209.1      GATATTGATGGACAGTATGCAATGACTCGAGCTCAGAGGGTACGAGCTGCTATGTTCCCT
                    ************************************************************

HsCD00329967        GAGACATTAGATGAGGGCATGCAGATCCCATCTACACAGTTTGATGCTGCTCATCCCACT
NM_001098210.1      GAGACATTAGATGAGGGCATGCAGATCCCATCTACACAGTTTGATGCTGCTCATCCCACT
NM_001904.3         GAGACATTAGATGAGGGCATGCAGATCCCATCTACACAGTTTGATGCTGCTCATCCCACT
NM_001098209.1      GAGACATTAGATGAGGGCATGCAGATCCCATCTACACAGTTTGATGCTGCTCATCCCACT
                    ************************************************************

HsCD00329967        AATGTCCAGCGTTTGGCTGAACCATCACAGATGCTGAAACATGCAGTTGTAAACTTGATT
NM_001098210.1      AATGTCCAGCGTTTGGCTGAACCATCACAGATGCTGAAACATGCAGTTGTAAACTTGATT
NM_001904.3         AATGTCCAGCGTTTGGCTGAACCATCACAGATGCTGAAACATGCAGTTGTAAACTTGATT
NM_001098209.1      AATGTCCAGCGTTTGGCTGAACCATCACAGATGCTGAAACATGCAGTTGTAAACTTGATT
                    ************************************************************

HsCD00329967        AACTATCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGACAAAACTGCTA
NM_001098210.1      AACTATCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGACAAAACTGCTA
NM_001904.3         AACTATCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGACAAAACTGCTA
NM_001098209.1      AACTATCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGACAAAACTGCTA
                    ************************************************************

HsCD00329967        AATGACGAGGACCAGGTGGTGGTTAATAAGGCTGCAGTTATGGTCCATCAGCTTTCTAAA
NM_001098210.1      AATGACGAGGACCAGGTGGTGGTTAATAAGGCTGCAGTTATGGTCCATCAGCTTTCTAAA
NM_001904.3         AATGACGAGGACCAGGTGGTGGTTAATAAGGCTGCAGTTATGGTCCATCAGCTTTCTAAA
NM_001098209.1      AATGACGAGGACCAGGTGGTGGTTAATAAGGCTGCAGTTATGGTCCATCAGCTTTCTAAA
                    ************************************************************

HsCD00329967        AAGGAAGCTTCCAGACACGCTATCATGCGTTCTCCTCAGATGGTGTCTGCTATTGTACGT
NM_001098210.1      AAGGAAGCTTCCAGACACGCTATCATGCGTTCTCCTCAGATGGTGTCTGCTATTGTACGT
NM_001904.3         AAGGAAGCTTCCAGACACGCTATCATGCGTTCTCCTCAGATGGTGTCTGCTATTGTACGT
NM_001098209.1      AAGGAAGCTTCCAGACACGCTATCATGCGTTCTCCTCAGATGGTGTCTGCTATTGTACGT
                    ************************************************************

HsCD00329967        ACCATGCAGAATACAAATGATGTAGAAACAGCTCGTTGTACCGCTGGGACCTTGCATAAC
NM_001098210.1      ACCATGCAGAATACAAATGATGTAGAAACAGCTCGTTGTACCGCTGGGACCTTGCATAAC
NM_001904.3         ACCATGCAGAATACAAATGATGTAGAAACAGCTCGTTGTACCGCTGGGACCTTGCATAAC
NM_001098209.1      ACCATGCAGAATACAAATGATGTAGAAACAGCTCGTTGTACCGCTGGGACCTTGCATAAC
                    ************************************************************

HsCD00329967        CTTTCCCATCATCGTGAGGGCTTACTGGCCATCTTTAAGTCTGGAGGCATTCCTGCCCTG
NM_001098210.1      CTTTCCCATCATCGTGAGGGCTTACTGGCCATCTTTAAGTCTGGAGGCATTCCTGCCCTG
NM_001904.3         CTTTCCCATCATCGTGAGGGCTTACTGGCCATCTTTAAGTCTGGAGGCATTCCTGCCCTG
NM_001098209.1      CTTTCCCATCATCGTGAGGGCTTACTGGCCATCTTTAAGTCTGGAGGCATTCCTGCCCTG
                    ************************************************************

HsCD00329967        GTGAAAATGCTTGGTTCACCAGTGGATTCTGTGTTGTTTTATGCCATTACAACTCTCCAC
NM_001098210.1      GTGAAAATGCTTGGTTCACCAGTGGATTCTGTGTTGTTTTATGCCATTACAACTCTCCAC
NM_001904.3         GTGAAAATGCTTGGTTCACCAGTGGATTCTGTGTTGTTTTATGCCATTACAACTCTCCAC
NM_001098209.1      GTGAAAATGCTTGGTTCACCAGTGGATTCTGTGTTGTTTTATGCCATTACAACTCTCCAC
                    ************************************************************

HsCD00329967        AACCTTTTATTACATCAAGAAGGAGCTAAAATGGCAGTGCGTTTAGCTGGTGGGCTGCAG
NM_001098210.1      AACCTTTTATTACATCAAGAAGGAGCTAAAATGGCAGTGCGTTTAGCTGGTGGGCTGCAG
NM_001904.3         AACCTTTTATTACATCAAGAAGGAGCTAAAATGGCAGTGCGTTTAGCTGGTGGGCTGCAG
NM_001098209.1      AACCTTTTATTACATCAAGAAGGAGCTAAAATGGCAGTGCGTTTAGCTGGTGGGCTGCAG
                    ************************************************************

HsCD00329967        AAAATGGTTGCCTTGCTCAACAAAACAAATGTTAAATTCTTGGCTATTACGACAGACTGC
NM_001098210.1      AAAATGGTTGCCTTGCTCAACAAAACAAATGTTAAATTCTTGGCTATTACGACAGACTGC
NM_001904.3         AAAATGGTTGCCTTGCTCAACAAAACAAATGTTAAATTCTTGGCTATTACGACAGACTGC
NM_001098209.1      AAAATGGTTGCCTTGCTCAACAAAACAAATGTTAAATTCTTGGCTATTACGACAGACTGC
                    ************************************************************

HsCD00329967        CTTCAAATTTTAGCTTATGGCAACCAAGAAAGCAAGCTCATCATACTGGCTAGTGGTGGA
NM_001098210.1      CTTCAAATTTTAGCTTATGGCAACCAAGAAAGCAAGCTCATCATACTGGCTAGTGGTGGA
NM_001904.3         CTTCAAATTTTAGCTTATGGCAACCAAGAAAGCAAGCTCATCATACTGGCTAGTGGTGGA
NM_001098209.1      CTTCAAATTTTAGCTTATGGCAACCAAGAAAGCAAGCTCATCATACTGGCTAGTGGTGGA
                    ************************************************************

HsCD00329967        CCCCAAGCTTTAGTAAATATAATGAGGACCTATACTTACGAAAAACTACTGTGGACCACA
NM_001098210.1      CCCCAAGCTTTAGTAAATATAATGAGGACCTATACTTACGAAAAACTACTGTGGACCACA
NM_001904.3         CCCCAAGCTTTAGTAAATATAATGAGGACCTATACTTACGAAAAACTACTGTGGACCACA
NM_001098209.1      CCCCAAGCTTTAGTAAATATAATGAGGACCTATACTTACGAAAAACTACTGTGGACCACA
                    ************************************************************

HsCD00329967        AGCAGAGTGCTGAAGGTGCTATCTGTCTGCTCTAGTAATAAGCCGGCTATTGTAGAAGCT
NM_001098210.1      AGCAGAGTGCTGAAGGTGCTATCTGTCTGCTCTAGTAATAAGCCGGCTATTGTAGAAGCT
NM_001904.3         AGCAGAGTGCTGAAGGTGCTATCTGTCTGCTCTAGTAATAAGCCGGCTATTGTAGAAGCT
NM_001098209.1      AGCAGAGTGCTGAAGGTGCTATCTGTCTGCTCTAGTAATAAGCCGGCTATTGTAGAAGCT
                    ************************************************************

HsCD00329967        GGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAAC
NM_001098210.1      GGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAAC
NM_001904.3         GGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAAC
NM_001098209.1      GGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAAC
                    ************************************************************

HsCD00329967        TGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGT
NM_001098210.1      TGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGT
NM_001904.3         TGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGT
NM_001098209.1      TGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGT
                    ************************************************************

HsCD00329967        CTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCA
NM_001098210.1      CTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCA
NM_001904.3         CTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCA
NM_001098209.1      CTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCA
                    ************************************************************

HsCD00329967        GCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAA
NM_001098210.1      GCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAA
NM_001904.3         GCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAA
NM_001098209.1      GCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAA
                    ************************************************************

HsCD00329967        GTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATC
NM_001098210.1      GTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATC
NM_001904.3         GTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATC
NM_001098209.1      GTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATC
                    ************************************************************

HsCD00329967        ACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATG
NM_001098210.1      ACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATG
NM_001904.3         ACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATG
NM_001098209.1      ACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATG
                    ************************************************************

HsCD00329967        GCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCA
NM_001098210.1      GCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCA
NM_001904.3         GCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCA
NM_001098209.1      GCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCA
                    ************************************************************

HsCD00329967        CCATCCCACTGGCCTCTGATAAAGGCTACTGTTGGATTGATTCGAAATCTTGCCCTTTGT
NM_001098210.1      CCATCCCACTGGCCTCTGATAAAGGCTACTGTTGGATTGATTCGAAATCTTGCCCTTTGT
NM_001904.3         CCATCCCACTGGCCTCTGATAAAGGCTACTGTTGGATTGATTCGAAATCTTGCCCTTTGT
NM_001098209.1      CCATCCCACTGGCCTCTGATAAAGGCTACTGTTGGATTGATTCGAAATCTTGCCCTTTGT
                    ************************************************************

HsCD00329967        CCCGCAAATCATGCACCTTTGCGTGAGCAGGGTGCCATTCCACGACTAGTTCAGTTGCTT
NM_001098210.1      CCCGCAAATCATGCACCTTTGCGTGAGCAGGGTGCCATTCCACGACTAGTTCAGTTGCTT
NM_001904.3         CCCGCAAATCATGCACCTTTGCGTGAGCAGGGTGCCATTCCACGACTAGTTCAGTTGCTT
NM_001098209.1      CCCGCAAATCATGCACCTTTGCGTGAGCAGGGTGCCATTCCACGACTAGTTCAGTTGCTT
                    ************************************************************

HsCD00329967        GTTCGTGCACATCAGGATACCCAGCGCCGTACGTCCATGGGTGGGACACAGCAGCAATTT
NM_001098210.1      GTTCGTGCACATCAGGATACCCAGCGCCGTACGTCCATGGGTGGGACACAGCAGCAATTT
NM_001904.3         GTTCGTGCACATCAGGATACCCAGCGCCGTACGTCCATGGGTGGGACACAGCAGCAATTT
NM_001098209.1      GTTCGTGCACATCAGGATACCCAGCGCCGTACGTCCATGGGTGGGACACAGCAGCAATTT
                    ************************************************************

HsCD00329967        GTGGAGGGGGTCCGCATGGAAGAAATAGTTGAAGGTTGTACCGGAGCCCTTCACATCCTA
NM_001098210.1      GTGGAGGGGGTCCGCATGGAAGAAATAGTTGAAGGTTGTACCGGAGCCCTTCACATCCTA
NM_001904.3         GTGGAGGGGGTCCGCATGGAAGAAATAGTTGAAGGTTGTACCGGAGCCCTTCACATCCTA
NM_001098209.1      GTGGAGGGGGTCCGCATGGAAGAAATAGTTGAAGGTTGTACCGGAGCCCTTCACATCCTA
                    ************************************************************

HsCD00329967        GCTCGGGATGTTCACAACCGAATTGTTATCAGAGGACTAAATACCATTCCATTGTTTGTG
NM_001098210.1      GCTCGGGATGTTCACAACCGAATTGTTATCAGAGGACTAAATACCATTCCATTGTTTGTG
NM_001904.3         GCTCGGGATGTTCACAACCGAATTGTTATCAGAGGACTAAATACCATTCCATTGTTTGTG
NM_001098209.1      GCTCGGGATGTTCACAACCGAATTGTTATCAGAGGACTAAATACCATTCCATTGTTTGTG
                    ************************************************************

HsCD00329967        CAGCTGCTTTATTCTCCCATTGAAAACATCCAAAGAGTAGCTGCAGGGGTCCTCTGTGAA
NM_001098210.1      CAGCTGCTTTATTCTCCCATTGAAAACATCCAAAGAGTAGCTGCAGGGGTCCTCTGTGAA
NM_001904.3         CAGCTGCTTTATTCTCCCATTGAAAACATCCAAAGAGTAGCTGCAGGGGTCCTCTGTGAA
NM_001098209.1      CAGCTGCTTTATTCTCCCATTGAAAACATCCAAAGAGTAGCTGCAGGGGTCCTCTGTGAA
                    ************************************************************

HsCD00329967        CTTGCTCAGGACAAGGAAGCTGCAGAAGCTATTGAAGCTGAGGGAGCCACAGCTCCTCTG
NM_001098210.1      CTTGCTCAGGACAAGGAAGCTGCAGAAGCTATTGAAGCTGAGGGAGCCACAGCTCCTCTG
NM_001904.3         CTTGCTCAGGACAAGGAAGCTGCAGAAGCTATTGAAGCTGAGGGAGCCACAGCTCCTCTG
NM_001098209.1      CTTGCTCAGGACAAGGAAGCTGCAGAAGCTATTGAAGCTGAGGGAGCCACAGCTCCTCTG
                    ************************************************************

HsCD00329967        ACAGAGTTACTTCACTCTAGGAATGAAGGTGTGGCGACATATGCAGCTGCTGTTTTGTTC
NM_001098210.1      ACAGAGTTACTTCACTCTAGGAATGAAGGTGTGGCGACATATGCAGCTGCTGTTTTGTTC
NM_001904.3         ACAGAGTTACTTCACTCTAGGAATGAAGGTGTGGCGACATATGCAGCTGCTGTTTTGTTC
NM_001098209.1      ACAGAGTTACTTCACTCTAGGAATGAAGGTGTGGCGACATATGCAGCTGCTGTTTTGTTC
                    ************************************************************

HsCD00329967        CGAATGTCTGAGGACAAGCCACAAGATTACAAGAAACGGCTTTCAGTTGAGCTGACCAGC
NM_001098210.1      CGAATGTCTGAGGACAAGCCACAAGATTACAAGAAACGGCTTTCAGTTGAGCTGACCAGC
NM_001904.3         CGAATGTCTGAGGACAAGCCACAAGATTACAAGAAACGGCTTTCAGTTGAGCTGACCAGC
NM_001098209.1      CGAATGTCTGAGGACAAGCCACAAGATTACAAGAAACGGCTTTCAGTTGAGCTGACCAGC
                    ************************************************************

HsCD00329967        TCTCTCTTCAGAACAGAGCCAATGGCTTGGAATGAGACTGCTGATCTTGGACTTGATATT
NM_001098210.1      TCTCTCTTCAGAACAGAGCCAATGGCTTGGAATGAGACTGCTGATCTTGGACTTGATATT
NM_001904.3         TCTCTCTTCAGAACAGAGCCAATGGCTTGGAATGAGACTGCTGATCTTGGACTTGATATT
NM_001098209.1      TCTCTCTTCAGAACAGAGCCAATGGCTTGGAATGAGACTGCTGATCTTGGACTTGATATT
                    ************************************************************

HsCD00329967        GGTGCCCAGGGAGAACCCCTTGGATATCGCCAGGATGATCCTAGCTATCGTTCTTTTCAC
NM_001098210.1      GGTGCCCAGGGAGAACCCCTTGGATATCGCCAGGATGATCCTAGCTATCGTTCTTTTCAC
NM_001904.3         GGTGCCCAGGGAGAACCCCTTGGATATCGCCAGGATGATCCTAGCTATCGTTCTTTTCAC
NM_001098209.1      GGTGCCCAGGGAGAACCCCTTGGATATCGCCAGGATGATCCTAGCTATCGTTCTTTTCAC
                    ************************************************************

HsCD00329967        TCTGGTGGATATGGCCAGGATGCCTTGGGTATGGACCCCATGATGGAACATGAGATGGGT
NM_001098210.1      TCTGGTGGATATGGCCAGGATGCCTTGGGTATGGACCCCATGATGGAACATGAGATGGGT
NM_001904.3         TCTGGTGGATATGGCCAGGATGCCTTGGGTATGGACCCCATGATGGAACATGAGATGGGT
NM_001098209.1      TCTGGTGGATATGGCCAGGATGCCTTGGGTATGGACCCCATGATGGAACATGAGATGGGT
                    ************************************************************

HsCD00329967        GGCCACCACCCTGGTGCTGACTATCCAGTTGATGGGCTGCCAGATCTGGGGCATGCCCAG
NM_001098210.1      GGCCACCACCCTGGTGCTGACTATCCAGTTGATGGGCTGCCAGATCTGGGGCATGCCCAG
NM_001904.3         GGCCACCACCCTGGTGCTGACTATCCAGTTGATGGGCTGCCAGATCTGGGGCATGCCCAG
NM_001098209.1      GGCCACCACCCTGGTGCTGACTATCCAGTTGATGGGCTGCCAGATCTGGGGCATGCCCAG
                    ************************************************************

HsCD00329967        GACCTCATGGATGGGCTGCCTCCAGGTGACAGCAATCAGCTGGCCTGGTTTGATACTGAC
NM_001098210.1      GACCTCATGGATGGGCTGCCTCCAGGTGACAGCAATCAGCTGGCCTGGTTTGATACTGAC
NM_001904.3         GACCTCATGGATGGGCTGCCTCCAGGTGACAGCAATCAGCTGGCCTGGTTTGATACTGAC
NM_001098209.1      GACCTCATGGATGGGCTGCCTCCAGGTGACAGCAATCAGCTGGCCTGGTTTGATACTGAC
                    ************************************************************

HsCD00329967        CTGTTG
NM_001098210.1      CTGTAA
NM_001904.3         CTGTAA
NM_001098209.1      CTGTAA
                    ****:.

Pathways

NCI : AP-1 transcription factor network
NCI : Arf6 trafficking events
NCI : CDC42 signaling events
NCI : Canonical Wnt signaling pathway
NCI : Coregulation of Androgen receptor activity
NCI : Degradation of beta catenin
NCI : E-cadherin signaling events
NCI : E-cadherin signaling in keratinocytes
NCI : E-cadherin signaling in the nascent adherens junction
NCI : FoxO family signaling
NCI : Integrin-linked kinase signaling
NCI : N-cadherin signaling events
NCI : Nectin adhesion pathway
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Presenilin action in Notch and Wnt signaling
NCI : RAC1 signaling pathway
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Stabilization and expansion of the E-cadherin adherens junction
NCI : TGF-beta receptor signaling
Panther : Alzheimer disease-presenilin pathway
Panther : Angiogenesis
Panther : Cadherin signaling pathway
Panther : Wnt signaling pathway
Panther : p53 pathway feedback loops 2
Reactome : Adherens junctions interactions
Reactome : Apoptosis
Reactome : Apoptotic cleavage of cell adhesion proteins
Reactome : Apoptotic cleavage of cellular proteins
Reactome : Apoptotic execution phase
Reactome : Beta-catenin phosphorylation cascade
Reactome : CDO in myogenesis
Reactome : Ca2+ pathway
Reactome : Cell junction organization
Reactome : Cell-Cell communication
Reactome : Cell-cell junction organization
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Degradation of beta-catenin by the destruction complex
Reactome : Developmental Biology
Reactome : Immune System
Reactome : Incretin synthesis, secretion, and inactivation
Reactome : Innate Immune System
Reactome : LRR FLII-interacting protein 1 (LRRFIP1) activates type I IFN production
Reactome : Metabolism of proteins
Reactome : Myogenesis
Reactome : Peptide hormone metabolism
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : Synthesis, secretion, and inactivation of Glucagon-like Peptide-1 (GLP-1)
Reactome : TCF dependent signaling in response to WNT
Reactome : beta-catenin independent WNT signaling
Reactome : binding of TCF/LEF:CTNNB1 to target gene promoters
Reactome : deactivation of the beta-catenin transactivating complex
Reactome : disassembly of the destruction complex and recruitment of AXIN to the membrane
Reactome : formation of the beta-catenin:TCF transactivating complex
WikiPathway : Adipogenesis
WikiPathway : Androgen receptor signaling pathway
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Heart Development
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Leukocyte TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Muscle cell TarBase
WikiPathway : Neural Crest Differentiation
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Protein

SMART domain : ARM : Armadillo/beta-catenin-like repeats
UniProt : P35222
HPRD : 00286

Clone

Cloning Information : 268186
HIP Master Clone ID : 194845
Original Clone ID : FLH268186.01L

Organism


TAX_ID : 9606
Species Specific ID: 1499

Genome

Chromosome : 3
Map Location : 3p21
Ensembl : ENSG00000168036

Reagents

Labome : beta-catenin-antibody