DNASU Plasmid Repository • 480.965.5697 | Email

TCEA1 (Homo sapiens) in pLenti6.2/V5-DEST (V5-tagged lentiviral mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TCEA1
Gene Name:  transcription elongation factor A (SII), 1
Sequence             
Original Clone ID: FLH269517.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pLenti6.2/V5-DEST               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00330194

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 906nts        
Open reading frame : 1 to 906
Reference Sequence Alignment

ATGGAGGACGAAGTGGTCCGCTTTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAAC
GCGGCTGGAGCATTGGATTTGCTAAAGGAGCTTAAGAATATTCCTATGACCCTGGAATTA
CTGCAGTCCACAAGAATCGGAATGTCAGTTAATGCTATTCGCAAGCAGAGTACAGATGAG
GAAGTTACATCTTTGGCAAAGTCTCTCATCAAATCCTGGAAAAAATTATTAGATGGGCCA
TCAACTGAGAAAGACCTTGACGAAAAGAAGAAAGAACCTGCAATTACATCGCAGAACAGC
CCTGAGGCAAGAGAAGAAAGTACTTCCAGCGGCAATGTAAGCAACAGAAAGGATGAGACA
AATGCTCGAGATACTTATGTTTCATCCTTTCCTCGGGCACCAAGCACTTCTGATTCTGTG
CGGTTGAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGGGATGACTACATTGCA
ATTGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAAGAAGCTATATATCAAGAAATA
AGGAATACAGACATGAAATACAAAAATAGAGTACGAAGTAGGATATCAAATCTTAAAGAT
GCAAAAAATCCAAATTTAAGAAAAAATGTCCTCTGTGGGAATATTCCTCCTGACTTATTT
GCTAGAATGACAGCAGAGGAAATGGCTAGTGATGAGCTGAAAGAGATGCGGAAAAACTTG
ACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACTGGTGGGACCCAGACTGACTTG
TTCACATGTGGCAAATGTAAAAAGAAGAATTGCACTTACACACAGGTACAAACCCGTAGT
GCTGATGAACCAATGACAACATTTGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTC
TGTGAC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1010
Start on reference sequence 105
Mutations:
None
Discrepancy:
g621a
                                

5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pLenti6.2/V5-DEST

pLenti6.2V5-DEST in advanced viewed

Synonyms: pLenti6.2/V5-DEST
Sequencing Primer: Forward:  CMV forward
Reverse:  V5 reverse
Description: with tag/fusion/marker assay, Gateway®, acceptor (destination), recombinational cloning clone, lentiviral infection, mammalian expression expression with CMV and PGK and BlastR and AmpR and RSV and 5' splice donor and HIV-1 psi and HIV-1 RRE and 3' splice acceptor and V5 and SV40 and pUC ori and attR1 and attR2 and ccdB and CmR; blasticidin resistance in mammalian, ampicillin resistance in bacterial;
Comments: None
Size (bp): 8813
Parent Vector: None
Empty Vector: None
Properties: Gateway, acceptor (destination), lentiviral infection, mammalian expression, recombinational cloning, with tag/fusion/marker
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 7733 8406
death cassette ccdB ccdB death cassette (removed when insert is present) 3767 3976
packaging signal HIV-1 psi HIV-1 psi packaging signal 521 565
poly-A signal SV40 SV40 polyadenylation signal 5639 5770
promoter CMV CMV promoter driving gene of interest 1809 2392
promoter PGK PGK promoter to drive selection marker in mammalian cells 4266 4771
promoter RSV RSV/5' LTR hybrid promoter 1 410
recombination site attR1 attR1 recombinational cloning site 2440 2456
recombination site attR2 attR2 recombinational cloning site 4127 4142
response element HIV-1 RRE HIV-1 Rev response element (RRE) 1075 1308
selectable marker BlastR Blasticidin resistance gene in mammalian cells 4849 5249
selectable marker CmR chloramphenicol resistance marker (removed in plasmids with insert) 2673 3329
selectable marker AmpR Ampicillin resistance gene for selection in bacteria 6728 7588
splice acceptor site 3' splice acceptor two 3' splice acceptors at 1656 and 1684 1656 1656
splice donor site 5' splice donor 5' splice donor 520 520
tag V5 C-terminal V5 epitope tag 4197 4238

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TCEA1
Symbol Nomenclature : TCEA1
SYNONYM : GTF2S; SII; TCEA; TF2S; TFIIS
Designation : transcription elongation factor A protein 1|transcription elongation factor S-II protein 1|transcription elongation factor TFIIS.o
Full Nomenclature : transcription elongation factor A (SII), 1
GENEID : 6917
HGNC : 11612
MIM : 601425
Vega : OTTHUMG00000164262
Target GenBank: NM_006756

 

Reference Sequence Alignment

  

HsCD00330194      ATGGAGGACGAAGTGGTCCGCTTTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAAC
NM_006756.3       ATGGAGGACGAAGTGGTCCGCTTTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAAC
NM_201437.2       ATGGAGGACGAAGTGGTCCGCTTTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAAC
                  ************************************************************

HsCD00330194      GCGGCTGGAGCATTGGATTTGCTAAAGGAGCTTAAGAATATTCCTATGACCCTGGAATTA
NM_006756.3       GCGGCTGGAGCATTGGATTTGCTAAAGGAGCTTAAGAATATTCCTATGACCCTGGAATTA
NM_201437.2       GCG---------------------------------------------------------
                  ***                                                         

HsCD00330194      CTGCAGTCCACAAGAATCGGAATGTCAGTTAATGCTATTCGCAAGCAGAGTACAGATGAG
NM_006756.3       CTGCAGTCCACAAGAATCGGAATGTCAGTTAATGCTATTCGCAAGCAGAGTACAGATGAG
NM_201437.2       ------TCCACAAGAATCGGAATGTCAGTTAATGCTATTCGCAAGCAGAGTACAGATGAG
                        ******************************************************

HsCD00330194      GAAGTTACATCTTTGGCAAAGTCTCTCATCAAATCCTGGAAAAAATTATTAGATGGGCCA
NM_006756.3       GAAGTTACATCTTTGGCAAAGTCTCTCATCAAATCCTGGAAAAAATTATTAGATGGGCCA
NM_201437.2       GAAGTTACATCTTTGGCAAAGTCTCTCATCAAATCCTGGAAAAAATTATTAGATGGGCCA
                  ************************************************************

HsCD00330194      TCAACTGAGAAAGACCTTGACGAAAAGAAGAAAGAACCTGCAATTACATCGCAGAACAGC
NM_006756.3       TCAACTGAGAAAGACCTTGACGAAAAGAAGAAAGAACCTGCAATTACATCGCAGAACAGC
NM_201437.2       TCAACTGAGAAAGACCTTGACGAAAAGAAGAAAGAACCTGCAATTACATCGCAGAACAGC
                  ************************************************************

HsCD00330194      CCTGAGGCAAGAGAAGAAAGTACTTCCAGCGGCAATGTAAGCAACAGAAAGGATGAGACA
NM_006756.3       CCTGAGGCAAGAGAAGAAAGTACTTCCAGCGGCAATGTAAGCAACAGAAAGGATGAGACA
NM_201437.2       CCTGAGGCAAGAGAAGAAAGTACTTCCAGCGGCAATGTAAGCAACAGAAAGGATGAGACA
                  ************************************************************

HsCD00330194      AATGCTCGAGATACTTATGTTTCATCCTTTCCTCGGGCACCAAGCACTTCTGATTCTGTG
NM_006756.3       AATGCTCGAGATACTTATGTTTCATCCTTTCCTCGGGCACCAAGCACTTCTGATTCTGTG
NM_201437.2       AATGCTCGAGATACTTATGTTTCATCCTTTCCTCGGGCACCAAGCACTTCTGATTCTGTG
                  ************************************************************

HsCD00330194      CGGTTGAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGGGATGACTACATTGCA
NM_006756.3       CGGTTGAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGGGATGACTACATTGCA
NM_201437.2       CGGTTGAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGGGATGACTACATTGCA
                  ************************************************************

HsCD00330194      ATTGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAAGAAGCTATATATCAAGAAATA
NM_006756.3       ATTGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAAGAAGCTATATATCAAGAAATA
NM_201437.2       ATTGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAAGAAGCTATATATCAAGAAATA
                  ************************************************************

HsCD00330194      AGGAATACAGACATGAAATACAAAAATAGAGTACGAAGTAGGATATCAAATCTTAAAGAT
NM_006756.3       AGGAATACAGACATGAAATACAAAAATAGAGTACGAAGTAGGATATCAAATCTTAAAGAT
NM_201437.2       AGGAATACAGACATGAAATACAAAAATAGAGTACGAAGTAGGATATCAAATCTTAAAGAT
                  ************************************************************

HsCD00330194      GCAAAAAATCCAAATTTAAGAAAAAATGTCCTCTGTGGGAATATTCCTCCTGACTTATTT
NM_006756.3       GCAAAAAATCCAAATTTAAGGAAAAATGTCCTCTGTGGGAATATTCCTCCTGACTTATTT
NM_201437.2       GCAAAAAATCCAAATTTAAGGAAAAATGTCCTCTGTGGGAATATTCCTCCTGACTTATTT
                  ********************.***************************************

HsCD00330194      GCTAGAATGACAGCAGAGGAAATGGCTAGTGATGAGCTGAAAGAGATGCGGAAAAACTTG
NM_006756.3       GCTAGAATGACAGCAGAGGAAATGGCTAGTGATGAGCTGAAAGAGATGCGGAAAAACTTG
NM_201437.2       GCTAGAATGACAGCAGAGGAAATGGCTAGTGATGAGCTGAAAGAGATGCGGAAAAACTTG
                  ************************************************************

HsCD00330194      ACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACTGGTGGGACCCAGACTGACTTG
NM_006756.3       ACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACTGGTGGGACCCAGACTGACTTG
NM_201437.2       ACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACTGGTGGGACCCAGACTGACTTG
                  ************************************************************

HsCD00330194      TTCACATGTGGCAAATGTAAAAAGAAGAATTGCACTTACACACAGGTACAAACCCGTAGT
NM_006756.3       TTCACATGTGGCAAATGTAAAAAGAAGAATTGCACTTACACACAGGTACAAACCCGTAGT
NM_201437.2       TTCACATGTGGCAAATGTAAAAAGAAGAATTGCACTTACACACAGGTACAAACCCGTAGT
                  ************************************************************

HsCD00330194      GCTGATGAACCAATGACAACATTTGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTC
NM_006756.3       GCTGATGAACCAATGACAACATTTGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTC
NM_201437.2       GCTGATGAACCAATGACAACATTTGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTC
                  ************************************************************

HsCD00330194      TGTGAC
NM_006756.3       TGTTGA
NM_201437.2       TGTTGA
                  *** ..

Pathways

Reactome : Disease
Reactome : DNA Repair
Reactome : Dual incision reaction in TC-NER
Reactome : Elongation arrest and recovery
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Formation of transcription-coupled NER (TC-NER) repair complex
Reactome : Gene Expression
Reactome : HIV elongation arrest and recovery
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : Late Phase of HIV Life Cycle
Reactome : Nucleotide Excision Repair
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcription-coupled NER (TC-NER)

Clone

Cloning Information : 269517
HIP Master Clone ID : 107307
Original Clone ID : FLH269517.01L

Organism


TAX_ID : 9606
Species Specific ID: 6917

Genome

Chromosome : 8
Map Location : 8q11.2
Ensembl : ENSG00000187735

Reagents

Labome : TCEA1-antibody