DNASU Plasmid Repository • 480.965.5697 | Email

PLK (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PLK1
Gene Name:  polo-like kinase 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000118.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00003326

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1812nts         Open reading frame : 1 to 1812
Reference Sequence Alignment

ATGAGTGCTGCAGTGACTGCAGGGAAGCTGGCACGGGCACCGGCCGACCCTGGGAAAGCC
GGGGTCCCCGGAGTTGCAGCTCCCGGAGCTCCGGCGGCGGCTCCACCGGCGAAAGAGATC
CCGGAGGTCCTAGTGGACCCACGCAGCCGGCGGCGCTATGTGCGGGGCCGCTTTTTGGGC
AAGGGCGGCTTTGCCAAGTGCTTCGAGATCTCGGACGCGGACACCAAGGAGGTGTTCGCG
GGCAAGATTGTGCCTAAGTCTCTGCTGCTCAAGCCGCACCAGAGGGAGAAGATGTCCATG
GAAATATCCATTCACCGCAGCCTCGCCCACCAGCACGTCGTAGGATTCCACGGCTTTTTC
GAGGACAACGACTTCGTGTTCGTGGTGTTGGAGCTCTGCCGCCGGAGGTCTCTCCTGGAG
CTGCACAAGAGGAGGAAAGCCCTGACTGAGCCTGAGGCCCGATACTACCTACGGCAAATT
GTGCTTGGCTGCCAGTACCTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGC
AACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAA
GTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCC
GAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATC
ATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTAC
CTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCC
CTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCTT
AATGACGAGTTCTTTACTTCTGGCTATATCCCTGCCCGTCTCCCCATCACCTGCCTGACC
ATTCCACCAAGGTTTTCGATTGCTCCCAGCAGCCTGGACCCCAGCAACCGGAAGCCCCTC
ACAGTCCTCAATAAAGGCTTGGAGAACCCCCTGCCTGAGCGTCCCCGGGAAAAAGAAGAA
CCAGTGGTTCGAGAGACAGGTGAGGTGGTCGACTGCCACCTCAGTGACATGCTGCAGCAG
CTGCACAGTGTCAATGCCTCCAAGCCCTCGGAGCGTGGGCTGGTCAGGCAAGAGGAGGCT
GAGGATCCTGCCTGCATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGGACAAG
TACGGCCTTGGGTATCAGCTCTGTGATAACAGCGTGGGGGTGCTCTTCAATGACTCAACA
CGCCTCATCCTCTACAATGATGGTGACAGCCTGCAGTACATAGAGCGTGACGGCACTGAG
TCCTACCTCACCGTGAGTTCCCATCCCAACTCCTTGATGAAGAAGATCACCCTCCTTAAA
TATTTCCGCAATTACATGAGCGAGCACTTGCTGAAGGCAGGTGCCAACATCACGCCGCGC
GAAGGTGATGAGCTCGCCCGGCTGCCCTACCTACGGACCTGGTTCCGCACCCGCAGCGCC
ATCATCCTGCACCTCAGCAACGGCAGCGTGCAGATCAACTTCTTCCAGGATCACACCAAG
CTCATCTTGTGCCCACTGATGGCAGCCGTGACCTACATCGACGAGAAGCGGGACTTCCGC
ACATACCGCCTGAGTCTCCTGGAGGAGTACGGCTGCTGCAAGGAGCTGGCCAGCCGGCTC
CGCTACGCCCGCACTATGGTGGACAAGCTGCTGAGCTCACGCTCGGCCAGCAACCGTCTC
AAGGCCTCCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1843
Start on reference sequence 32
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PLK1
Symbol Nomenclature : PLK1
SYNONYM : PLK; STPK13
Designation : PLK-1|cell cycle regulated protein kinase|polo (Drosophia)-like kinase|polo like kinase|serine/threonine-protein kinase 13|serine/threonine-protein kinase PLK1
Full Nomenclature : polo-like kinase 1
GENEID : 5347
GI : 33303978
GenBank Accession : AY335670
HGNC : 9077
MIM : 602098
Vega : OTTHUMG00000096984
Target GenBank: BC003002

 

Reference Sequence Alignment

  

HsCD00003326      ATGAGTGCTGCAGTGACTGCAGGGAAGCTGGCACGGGCACCGGCCGACCCTGGGAAAGCC
NM_005030.3       ATGAGTGCTGCAGTGACTGCAGGGAAGCTGGCACGGGCACCGGCCGACCCTGGGAAAGCC
                  ************************************************************

HsCD00003326      GGGGTCCCCGGAGTTGCAGCTCCCGGAGCTCCGGCGGCGGCTCCACCGGCGAAAGAGATC
NM_005030.3       GGGGTCCCCGGAGTTGCAGCTCCCGGAGCTCCGGCGGCGGCTCCACCGGCGAAAGAGATC
                  ************************************************************

HsCD00003326      CCGGAGGTCCTAGTGGACCCACGCAGCCGGCGGCGCTATGTGCGGGGCCGCTTTTTGGGC
NM_005030.3       CCGGAGGTCCTAGTGGACCCACGCAGCCGGCGGCGCTATGTGCGGGGCCGCTTTTTGGGC
                  ************************************************************

HsCD00003326      AAGGGCGGCTTTGCCAAGTGCTTCGAGATCTCGGACGCGGACACCAAGGAGGTGTTCGCG
NM_005030.3       AAGGGCGGCTTTGCCAAGTGCTTCGAGATCTCGGACGCGGACACCAAGGAGGTGTTCGCG
                  ************************************************************

HsCD00003326      GGCAAGATTGTGCCTAAGTCTCTGCTGCTCAAGCCGCACCAGAGGGAGAAGATGTCCATG
NM_005030.3       GGCAAGATTGTGCCTAAGTCTCTGCTGCTCAAGCCGCACCAGAGGGAGAAGATGTCCATG
                  ************************************************************

HsCD00003326      GAAATATCCATTCACCGCAGCCTCGCCCACCAGCACGTCGTAGGATTCCACGGCTTTTTC
NM_005030.3       GAAATATCCATTCACCGCAGCCTCGCCCACCAGCACGTCGTAGGATTCCACGGCTTTTTC
                  ************************************************************

HsCD00003326      GAGGACAACGACTTCGTGTTCGTGGTGTTGGAGCTCTGCCGCCGGAGGTCTCTCCTGGAG
NM_005030.3       GAGGACAACGACTTCGTGTTCGTGGTGTTGGAGCTCTGCCGCCGGAGGTCTCTCCTGGAG
                  ************************************************************

HsCD00003326      CTGCACAAGAGGAGGAAAGCCCTGACTGAGCCTGAGGCCCGATACTACCTACGGCAAATT
NM_005030.3       CTGCACAAGAGGAGGAAAGCCCTGACTGAGCCTGAGGCCCGATACTACCTACGGCAAATT
                  ************************************************************

HsCD00003326      GTGCTTGGCTGCCAGTACCTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGC
NM_005030.3       GTGCTTGGCTGCCAGTACCTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGC
                  ************************************************************

HsCD00003326      AACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAA
NM_005030.3       AACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAA
                  ************************************************************

HsCD00003326      GTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCC
NM_005030.3       GTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCC
                  ************************************************************

HsCD00003326      GAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATC
NM_005030.3       GAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATC
                  ************************************************************

HsCD00003326      ATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTAC
NM_005030.3       ATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTAC
                  ************************************************************

HsCD00003326      CTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCC
NM_005030.3       CTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCC
                  ************************************************************

HsCD00003326      CTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCTT
NM_005030.3       CTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCTT
                  ************************************************************

HsCD00003326      AATGACGAGTTCTTTACTTCTGGCTATATCCCTGCCCGTCTCCCCATCACCTGCCTGACC
NM_005030.3       AATGACGAGTTCTTTACTTCTGGCTATATCCCTGCCCGTCTCCCCATCACCTGCCTGACC
                  ************************************************************

HsCD00003326      ATTCCACCAAGGTTTTCGATTGCTCCCAGCAGCCTGGACCCCAGCAACCGGAAGCCCCTC
NM_005030.3       ATTCCACCAAGGTTTTCGATTGCTCCCAGCAGCCTGGACCCCAGCAACCGGAAGCCCCTC
                  ************************************************************

HsCD00003326      ACAGTCCTCAATAAAGGCTTGGAGAACCCCCTGCCTGAGCGTCCCCGGGAAAAAGAAGAA
NM_005030.3       ACAGTCCTCAATAAAGGCTTGGAGAACCCCCTGCCTGAGCGTCCCCGGGAAAAAGAAGAA
                  ************************************************************

HsCD00003326      CCAGTGGTTCGAGAGACAGGTGAGGTGGTCGACTGCCACCTCAGTGACATGCTGCAGCAG
NM_005030.3       CCAGTGGTTCGAGAGACAGGTGAGGTGGTCGACTGCCACCTCAGTGACATGCTGCAGCAG
                  ************************************************************

HsCD00003326      CTGCACAGTGTCAATGCCTCCAAGCCCTCGGAGCGTGGGCTGGTCAGGCAAGAGGAGGCT
NM_005030.3       CTGCACAGTGTCAATGCCTCCAAGCCCTCGGAGCGTGGGCTGGTCAGGCAAGAGGAGGCT
                  ************************************************************

HsCD00003326      GAGGATCCTGCCTGCATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGGACAAG
NM_005030.3       GAGGATCCTGCCTGCATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGGACAAG
                  ************************************************************

HsCD00003326      TACGGCCTTGGGTATCAGCTCTGTGATAACAGCGTGGGGGTGCTCTTCAATGACTCAACA
NM_005030.3       TACGGCCTTGGGTATCAGCTCTGTGATAACAGCGTGGGGGTGCTCTTCAATGACTCAACA
                  ************************************************************

HsCD00003326      CGCCTCATCCTCTACAATGATGGTGACAGCCTGCAGTACATAGAGCGTGACGGCACTGAG
NM_005030.3       CGCCTCATCCTCTACAATGATGGTGACAGCCTGCAGTACATAGAGCGTGACGGCACTGAG
                  ************************************************************

HsCD00003326      TCCTACCTCACCGTGAGTTCCCATCCCAACTCCTTGATGAAGAAGATCACCCTCCTTAAA
NM_005030.3       TCCTACCTCACCGTGAGTTCCCATCCCAACTCCTTGATGAAGAAGATCACCCTCCTTAAA
                  ************************************************************

HsCD00003326      TATTTCCGCAATTACATGAGCGAGCACTTGCTGAAGGCAGGTGCCAACATCACGCCGCGC
NM_005030.3       TATTTCCGCAATTACATGAGCGAGCACTTGCTGAAGGCAGGTGCCAACATCACGCCGCGC
                  ************************************************************

HsCD00003326      GAAGGTGATGAGCTCGCCCGGCTGCCCTACCTACGGACCTGGTTCCGCACCCGCAGCGCC
NM_005030.3       GAAGGTGATGAGCTCGCCCGGCTGCCCTACCTACGGACCTGGTTCCGCACCCGCAGCGCC
                  ************************************************************

HsCD00003326      ATCATCCTGCACCTCAGCAACGGCAGCGTGCAGATCAACTTCTTCCAGGATCACACCAAG
NM_005030.3       ATCATCCTGCACCTCAGCAACGGCAGCGTGCAGATCAACTTCTTCCAGGATCACACCAAG
                  ************************************************************

HsCD00003326      CTCATCTTGTGCCCACTGATGGCAGCCGTGACCTACATCGACGAGAAGCGGGACTTCCGC
NM_005030.3       CTCATCTTGTGCCCACTGATGGCAGCCGTGACCTACATCGACGAGAAGCGGGACTTCCGC
                  ************************************************************

HsCD00003326      ACATACCGCCTGAGTCTCCTGGAGGAGTACGGCTGCTGCAAGGAGCTGGCCAGCCGGCTC
NM_005030.3       ACATACCGCCTGAGTCTCCTGGAGGAGTACGGCTGCTGCAAGGAGCTGGCCAGCCGGCTC
                  ************************************************************

HsCD00003326      CGCTACGCCCGCACTATGGTGGACAAGCTGCTGAGCTCACGCTCGGCCAGCAACCGTCTC
NM_005030.3       CGCTACGCCCGCACTATGGTGGACAAGCTGCTGAGCTCACGCTCGGCCAGCAACCGTCTC
                  ************************************************************

HsCD00003326      AAGGCCTCCTTG
NM_005030.3       AAGGCCTCCTAA
                  **********:.

Pathways

NCI : ATR signaling pathway
NCI : FOXM1 transcription factor network
NCI : FoxO family signaling
NCI : PLK1 signaling events
NCI : Polo-like kinase signaling events in the cell cycle
NCI : Validated transcriptional targets of TAp63 isoforms
NCI : p73 transcription factor network
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of NIMA Kinases NEK9, NEK6, NEK7
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Centrosome maturation
Reactome : Condensation of Prophase Chromosomes
Reactome : Cyclin A/B1 associated events during G2/M transition
Reactome : G2/M Transition
Reactome : Golgi Cisternae Pericentriolar Stack Reorganization
Reactome : Loss of Nlp from mitotic centrosomes
Reactome : Loss of proteins required for interphase microtubule organizationÿ from the centrosome
Reactome : M Phase
Reactome : Mitotic Anaphase
Reactome : Mitotic G2-G2/M phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Metaphase/Anaphase Transition
Reactome : Mitotic Prometaphase
Reactome : Mitotic Prophase
Reactome : Mitotic Telophase/Cytokinesis
Reactome : Nuclear Envelope Breakdown
Reactome : Phosphorylation of Emi1
Reactome : Phosphorylation of the APC/C
Reactome : Polo-like kinase mediated events
Reactome : Recruitment of mitotic centrosome proteins and complexes
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Regulation of mitotic cell cycle
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : Separation of Sister Chromatids
WikiPathway : Cell cycle
WikiPathway : Epithelium TarBase
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TNF alpha Signaling Pathway

Clone

Cloning Information : 118
HIP Master Clone ID : 87374
Original Clone ID : FLH000118.01L

Organism


TAX_ID : 9606
Species Specific ID: 5347

Genome

Chromosome : 16
Map Location : 16p12.2
Ensembl : ENSG00000166851

Reagents

Labome : Plk1-antibody