DNASU Plasmid Repository • 480.965.5697 | Email

RUVBL1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RUVBL1
Gene Name:  RuvB-like AAA ATPase 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH023918.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003331

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1371nts         Open reading frame : 1 to 1371
Reference Sequence Alignment

ATGAAGATTGAGGAGGTGAAGAGCACTACGAAGACGCAGCGCATCGCCTCCCACAGCCAC
GTGAAAGGGCTGGGGCTGGACGAGAGCGGCTTGGCCAAGCAGGCGGCCTCAGGGCTTGTG
GGCCAGGAGAACGCGCGAGAGGCATGTGGCGTCATAGTAGAATTAATCAAAAGCAAGAAA
ATGGCTGGAAGAGCTGTCTTGTTGGCAGGACCTCCTGGAACTGGCAAGACAGCTCTGGCT
CTGGCTATTGCTCAGGAGCTGGGTAGTAAGGTCCCCTTCTGCCCAATGGTGGGGAGTGAA
GTTTACTCAACTGAGATCAAGAAGACAGAGGTGCTGATGGAGAACTTCCGCAGGGCCATT
GGGCTGCGAATAAAGGAGACCAAGGAAGTTTATGAAGGTGAAGTCACAGAGCTAACTCCG
TGTGAGACAGAGAATCCCATGGGAGGATATGGCAAAACCATTAGCCATGTGATCATAGGA
CTCAAAACAGCCAAAGGAACCAAACAGTTGAAACTGGACCCCAGCATTTTTGAAAGTTTG
CAGAAAGAGCGAGTAGAAGCTGGAGATGTGATTTACATTGAAGCCAACAGTGGGGCCGTG
AAGAGGCAGGGCAGGTGTGATACCTATGCCACAGAATTCGACCTTGAAGCTGAAGAGTAT
GTCCCCTTGCCAAAAGGGGATGTGCACAAAAAGAAAGAAATCATCCAAGATGTGACCTTG
CATGACTTGGATGTGGCTAATGCGCGGCCCCAGGGGGGACAAGATATCCTGTCCATGATG
GGCCAGCTAATGAAGCCAAAGAAGACAGAAATCACAGACAAACTTCGAGGGGAGATTAAT
AAGGTGGTGAACAAGTACATCGACCAGGGCATTGCTGAGCTGGTCCCGGGTGTGCTGTTT
GTTGATGAGGTCCACATGCTGGACATTGAGTGCTTCACCTACCTGCACCGCGCCCTGGAG
TCTTCTATCGCTCCCATCGTCATCTTTGCATCCAACCGAGGCAACTGTGTCATCAGAGGC
ACTGAGGACATCACATCCCCTCACGGCATCCCTCTTGACCTTCTGGACCGAGTGATGATA
ATCCGGACCATGCTGTATACTCCACAGGAAATGAAACAGATCATTAAAATCCGTGCCCAG
ACGGAAGGAATCAACATCAGTGAGGAGGCACTGAACCACCTGGGGGAGATTGGCACCAAG
ACCACACTGAGGTACTCAGTGCAGCTGCTGACCCCGGCCAACTTGCTTGCTAAAATCAAC
GGGAAGGACAGCATTGAGAAAGAGCATGTCGAAGAGATCAGTGAACTTTTCTATGATGCC
AAGTCCTCCGCCAAAATCCTGGCTGACCAGCAGGATAAGTACATGAAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1442
Start on reference sequence 72
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RUVBL1
Symbol Nomenclature : RUVBL1
SYNONYM : ECP54; INO80H; NMP238; PONTIN; Pontin52; RVB1; TIH1; TIP49; TIP49A
Designation : 49 kDa TATA box-binding protein-interacting protein|49 kDa TBP-interacting protein|54 kDa erythrocyte cytosolic protein|ECP-54|INO80 complex subunit H|NMP 238|RuvB (E coli homolog)-like 1|TAP54-alpha|TATA binding protein interacting protein 49 kDa|TIP60-associated protein 54-alpha|nuclear matrix protein 238|pontin 52|ruvB-like 1
Full Nomenclature : RuvB-like AAA ATPase 1
GENEID : 8607
GI : 60655670
GenBank Accession : AY889608
HGNC : 10474
MIM : 603449
Vega : OTTHUMG00000159658
Target GenBank: BC002993

 

Reference Sequence Alignment

  

HsCD00003331      ATGAAGATTGAGGAGGTGAAGAGCACTACGAAGACGCAGCGCATCGCCTCCCACAGCCAC
NM_003707.2       ATGAAGATTGAGGAGGTGAAGAGCACTACGAAGACGCAGCGCATCGCCTCCCACAGCCAC
                  ************************************************************

HsCD00003331      GTGAAAGGGCTGGGGCTGGACGAGAGCGGCTTGGCCAAGCAGGCGGCCTCAGGGCTTGTG
NM_003707.2       GTGAAAGGGCTGGGGCTGGACGAGAGCGGCTTGGCCAAGCAGGCGGCCTCAGGGCTTGTG
                  ************************************************************

HsCD00003331      GGCCAGGAGAACGCGCGAGAGGCATGTGGCGTCATAGTAGAATTAATCAAAAGCAAGAAA
NM_003707.2       GGCCAGGAGAACGCGCGAGAGGCATGTGGCGTCATAGTAGAATTAATCAAAAGCAAGAAA
                  ************************************************************

HsCD00003331      ATGGCTGGAAGAGCTGTCTTGTTGGCAGGACCTCCTGGAACTGGCAAGACAGCTCTGGCT
NM_003707.2       ATGGCTGGAAGAGCTGTCTTGTTGGCAGGACCTCCTGGAACTGGCAAGACAGCTCTGGCT
                  ************************************************************

HsCD00003331      CTGGCTATTGCTCAGGAGCTGGGTAGTAAGGTCCCCTTCTGCCCAATGGTGGGGAGTGAA
NM_003707.2       CTGGCTATTGCTCAGGAGCTGGGTAGTAAGGTCCCCTTCTGCCCAATGGTGGGGAGTGAA
                  ************************************************************

HsCD00003331      GTTTACTCAACTGAGATCAAGAAGACAGAGGTGCTGATGGAGAACTTCCGCAGGGCCATT
NM_003707.2       GTTTACTCAACTGAGATCAAGAAGACAGAGGTGCTGATGGAGAACTTCCGCAGGGCCATT
                  ************************************************************

HsCD00003331      GGGCTGCGAATAAAGGAGACCAAGGAAGTTTATGAAGGTGAAGTCACAGAGCTAACTCCG
NM_003707.2       GGGCTGCGAATAAAGGAGACCAAGGAAGTTTATGAAGGTGAAGTCACAGAGCTAACTCCG
                  ************************************************************

HsCD00003331      TGTGAGACAGAGAATCCCATGGGAGGATATGGCAAAACCATTAGCCATGTGATCATAGGA
NM_003707.2       TGTGAGACAGAGAATCCCATGGGAGGATATGGCAAAACCATTAGCCATGTGATCATAGGA
                  ************************************************************

HsCD00003331      CTCAAAACAGCCAAAGGAACCAAACAGTTGAAACTGGACCCCAGCATTTTTGAAAGTTTG
NM_003707.2       CTCAAAACAGCCAAAGGAACCAAACAGTTGAAACTGGACCCCAGCATTTTTGAAAGTTTG
                  ************************************************************

HsCD00003331      CAGAAAGAGCGAGTAGAAGCTGGAGATGTGATTTACATTGAAGCCAACAGTGGGGCCGTG
NM_003707.2       CAGAAAGAGCGAGTAGAAGCTGGAGATGTGATTTACATTGAAGCCAACAGTGGGGCCGTG
                  ************************************************************

HsCD00003331      AAGAGGCAGGGCAGGTGTGATACCTATGCCACAGAATTCGACCTTGAAGCTGAAGAGTAT
NM_003707.2       AAGAGGCAGGGCAGGTGTGATACCTATGCCACAGAATTCGACCTTGAAGCTGAAGAGTAT
                  ************************************************************

HsCD00003331      GTCCCCTTGCCAAAAGGGGATGTGCACAAAAAGAAAGAAATCATCCAAGATGTGACCTTG
NM_003707.2       GTCCCCTTGCCAAAAGGGGATGTGCACAAAAAGAAAGAAATCATCCAAGATGTGACCTTG
                  ************************************************************

HsCD00003331      CATGACTTGGATGTGGCTAATGCGCGGCCCCAGGGGGGACAAGATATCCTGTCCATGATG
NM_003707.2       CATGACTTGGATGTGGCTAATGCGCGGCCCCAGGGGGGACAAGATATCCTGTCCATGATG
                  ************************************************************

HsCD00003331      GGCCAGCTAATGAAGCCAAAGAAGACAGAAATCACAGACAAACTTCGAGGGGAGATTAAT
NM_003707.2       GGCCAGCTAATGAAGCCAAAGAAGACAGAAATCACAGACAAACTTCGAGGGGAGATTAAT
                  ************************************************************

HsCD00003331      AAGGTGGTGAACAAGTACATCGACCAGGGCATTGCTGAGCTGGTCCCGGGTGTGCTGTTT
NM_003707.2       AAGGTGGTGAACAAGTACATCGACCAGGGCATTGCTGAGCTGGTCCCGGGTGTGCTGTTT
                  ************************************************************

HsCD00003331      GTTGATGAGGTCCACATGCTGGACATTGAGTGCTTCACCTACCTGCACCGCGCCCTGGAG
NM_003707.2       GTTGATGAGGTCCACATGCTGGACATTGAGTGCTTCACCTACCTGCACCGCGCCCTGGAG
                  ************************************************************

HsCD00003331      TCTTCTATCGCTCCCATCGTCATCTTTGCATCCAACCGAGGCAACTGTGTCATCAGAGGC
NM_003707.2       TCTTCTATCGCTCCCATCGTCATCTTTGCATCCAACCGAGGCAACTGTGTCATCAGAGGC
                  ************************************************************

HsCD00003331      ACTGAGGACATCACATCCCCTCACGGCATCCCTCTTGACCTTCTGGACCGAGTGATGATA
NM_003707.2       ACTGAGGACATCACATCCCCTCACGGCATCCCTCTTGACCTTCTGGACCGAGTGATGATA
                  ************************************************************

HsCD00003331      ATCCGGACCATGCTGTATACTCCACAGGAAATGAAACAGATCATTAAAATCCGTGCCCAG
NM_003707.2       ATCCGGACCATGCTGTATACTCCACAGGAAATGAAACAGATCATTAAAATCCGTGCCCAG
                  ************************************************************

HsCD00003331      ACGGAAGGAATCAACATCAGTGAGGAGGCACTGAACCACCTGGGGGAGATTGGCACCAAG
NM_003707.2       ACGGAAGGAATCAACATCAGTGAGGAGGCACTGAACCACCTGGGGGAGATTGGCACCAAG
                  ************************************************************

HsCD00003331      ACCACACTGAGGTACTCAGTGCAGCTGCTGACCCCGGCCAACTTGCTTGCTAAAATCAAC
NM_003707.2       ACCACACTGAGGTACTCAGTGCAGCTGCTGACCCCGGCCAACTTGCTTGCTAAAATCAAC
                  ************************************************************

HsCD00003331      GGGAAGGACAGCATTGAGAAAGAGCATGTCGAAGAGATCAGTGAACTTTTCTATGATGCC
NM_003707.2       GGGAAGGACAGCATTGAGAAAGAGCATGTCGAAGAGATCAGTGAACTTTTCTATGATGCC
                  ************************************************************

HsCD00003331      AAGTCCTCCGCCAAAATCCTGGCTGACCAGCAGGATAAGTACATGAAGTAG
NM_003707.2       AAGTCCTCCGCCAAAATCCTGGCTGACCAGCAGGATAAGTACATGAAGTGA
                  *************************************************..

Pathways

NCI : C-MYC pathway
NCI : Integrin-linked kinase signaling
NCI : Validated targets of C-MYC transcriptional activation
Reactome : Cell Cycle
Reactome : Chromatin modifying enzymes
Reactome : Chromatin organization
Reactome : Chromosome Maintenance
Reactome : Deposition of new CENPA-containing nucleosomes at the centromere
Reactome : Extension of Telomeres
Reactome : HATs acetylate histones
Reactome : Nucleosome assembly
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : TCF dependent signaling in response to WNT
Reactome : Telomere Extension By Telomerase
Reactome : Telomere Maintenance
Reactome : formation of the beta-catenin:TCF transactivating complex

Clone

Cloning Information : 23918
HIP Master Clone ID : 54294
Original Clone ID : FLH023918.01X

Organism


TAX_ID : 9606
Species Specific ID: 8607

Genome

Chromosome : 3
Map Location : 3q21
Ensembl : ENSG00000175792

Reagents

Labome : RUVBL1-antibody