DNASU Plasmid Repository • 480.965.5697 | Email

CCT2 (Homo sapiens) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CCT2
Gene Name:  chaperonin containing TCP1, subunit 2 (beta)
Sequence             
Original Clone ID: 13015a4BCt7p1
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: C-terminal 6-His, TOPO
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00333937

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1608nts         Open reading frame : 1 to 1608
Reference Sequence Alignment

GCACCTGTTAACATCTTTAAGGCAGGAGCTGATGAAGAGAGAGCAGAGACAGCTCGTCTG
ACTTCTTTTATTGGTGCCATCGCCATTGGAGACTTGGTAAAGAGCACCTTGGGACCCAAA
GGCATGGACAAAATTCTTCTAAGCAGTGGACGAGATGCCTCTCTTATGGTAACCAATGAT
GGTGCCACTATTCTAAAAAACATTGGTGTTGACAATCCAGCAGCTAAAGTTTTAGTTGAT
ATGTCAAGGGTTCAAGATGATGAAGTTGGTGATGGCACTACCTCTGTTACCGTTTTAGCA
GCAGAATTATTAAGGGAAGCAGAATCTTTAATTGCAAAAAAGATTCATCCACAGACCATC
ATAGCGGGTTGGAGAGAAGCCACGAAGGCTGCAAGAGAGGCGCTGTTGAGTTCTGCAGTT
GATCATGGTTCCGATGAAGTTAAATTCCGTCAAGATTTAATGAATATTGCGGGCACAACA
TTATCCTCAAAACTTCTTACTCATCACAAAGACCACTTTACAAAGTTAGCTGTAGAAGCA
GTTCTCAGACTGAAAGGCTCTGGCAACCTGGAGGCAATTCATATTATCAAGAAGCTAGGA
GGAAGTTTGGCAGATTCCTATTTAGATGAAGGCTTCCTGTTGGATAAAAAAATTGGAGTA
AATCAACCAAAACGAATTGAAAATGCTAAAATTCTTATTGCAAATACTGGTATGGATACA
GACAAAATAAAGATATTTGGTTCCCGGGTAAGAGTTGACTCTACAGCAAAGGTTGCAGAA
ATAGAACATGCGGAAAAGGAAAAAATGAAGGAGAAAGTTGAACGTATTCTTAAGCATGGA
ATAAATTGCTTTATTAACAGGCAATTAATTTATAATTATCCTGAACAGCTCTTTGGTGCT
GCTGGTGTCATGGCTATTGAGCATGCAGATTTTGCAGGTGTGGAACGCCTAGCTCTTGTC
ACAGGTGGTGAAATTGCCTCTACCTTTGATCACCCAGAACTGGTGAAGCTTGGAAGTTGC
AAACTTATCGAGGAAGTCATGATTGGAGAAGACAAACTCATTCACTTTTCTGGGGTTGCC
CTTGGTGAGGCTTGTACCATTGTTTTGCGTGGTGCCACTCAACAAATTTTAGATGAAGCA
GAAAGATCATTGCATGATGCTCTTTGTGTTCTTGCGCAAACTGTAAAGGACTCTAGAACA
GTTTATGGAGGAGGCTGTTCTGAGATGTTGATGGCTCATGCTGTGACACAGCTTGCCAAT
AGAACACCAGGCAAAGAAGCTGTTGCAATGGAGTCTTATGCTAAAGCACTGAGAATGTTG
CCAACCATCATAGCTGACAATGCAGGCTATGACAGTGCAGACCTGGTGGCACAGCTCAGG
GCTGCTCACAGTGAAGGCAATACCACTGCTGGATTGGATATGAGGGAAGGCACCATTGGA
GATATGGCTATCCTGGGTATAACAGAAAGTTTTCAAGTGAAGCGACAGGTTCTTCTGAGT
GCAGCTGAAGCAGCAGAGGTGATTCTGCGTGTGGACAACATCATCAAAGCGGCACCCAGG
AAACGTGTCCCTGATCACCACGAAGGGCATCATCACCATCACCACTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in NYSGXRC-13015a
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CCT2
Symbol Nomenclature : CCT2
SYNONYM : 99D8.1; CCT-beta; CCTB; HEL-S-100n; PRO1633; TCP-1-beta
Designation : T-complex protein 1 subunit beta|T-complex protein 1, beta subunit|chaperonin containing t-complex polypeptide 1, beta subunit|chaperonin containing t-complex polypeptide 1, subunit 2|epididymis secretory sperm binding protein Li 100n
Full Nomenclature : chaperonin containing TCP1, subunit 2 (beta)
GENEID : 10576
GI : 5453603
GenBank Accession : NM_006431
HGNC : 1615
MIM : 605139
Vega : OTTHUMG00000169383
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00333937        ------------------GCACCTGTTAACATCTTTAAGGCAGGAGCTGATGAAGAGAGA
NM_001198842.1      ------------------------------------------------------------
NM_006431.2         ATGGCGTCCCTTTCCCTTGCACCTGTTAACATCTTTAAGGCAGGAGCTGATGAAGAGAGA
                                                                                

HsCD00333937        GCAGAGACAGCTCGTCTGACTTCTTTTATTGGTGCCATCGCCATTGGAGACTTGGTAAAG
NM_001198842.1      ------------------------------------------------------------
NM_006431.2         GCAGAGACAGCTCGTCTGACTTCTTTTATTGGTGCCATCGCCATTGGAGACTTGGTAAAG
                                                                                

HsCD00333937        AGCACCTTGGGACCCAAAGGCATGGACAAAATTCTTCTAAGCAGTGGACGAGATGCCTCT
NM_001198842.1      ---------------------ATGGACAAAATTCTTCTAAGCAGTGGACGAGATGCCTCT
NM_006431.2         AGCACCTTGGGACCCAAAGGCATGGACAAAATTCTTCTAAGCAGTGGACGAGATGCCTCT
                                         ***************************************

HsCD00333937        CTTATGGTAACCAATGATGGTGCCACTATTCTAAAAAACATTGGTGTTGACAATCCAGCA
NM_001198842.1      CTTATGGTAACCAATGATGGTGCCACTATTCTAAAAAACATTGGTGTTGACAATCCAGCA
NM_006431.2         CTTATGGTAACCAATGATGGTGCCACTATTCTAAAAAACATTGGTGTTGACAATCCAGCA
                    ************************************************************

HsCD00333937        GCTAAAGTTTTAGTTGATATGTCAAGGGTTCAAGATGATGAAGTTGGTGATGGCACTACC
NM_001198842.1      GCTAAAGTTTTAGTTGATATGTCAAGGGTTCAAGATGATGAAGTTGGTGATGGCACTACC
NM_006431.2         GCTAAAGTTTTAGTTGATATGTCAAGGGTTCAAGATGATGAAGTTGGTGATGGCACTACC
                    ************************************************************

HsCD00333937        TCTGTTACCGTTTTAGCAGCAGAATTATTAAGGGAAGCAGAATCTTTAATTGCAAAAAAG
NM_001198842.1      TCTGTTACCGTTTTAGCAGCAGAATTATTAAGGGAAGCAGAATCTTTAATTGCAAAAAAG
NM_006431.2         TCTGTTACCGTTTTAGCAGCAGAATTATTAAGGGAAGCAGAATCTTTAATTGCAAAAAAG
                    ************************************************************

HsCD00333937        ATTCATCCACAGACCATCATAGCGGGTTGGAGAGAAGCCACGAAGGCTGCAAGAGAGGCG
NM_001198842.1      ATTCATCCACAGACCATCATAGCGGGTTGGAGAGAAGCCACGAAGGCTGCAAGAGAGGCG
NM_006431.2         ATTCATCCACAGACCATCATAGCGGGTTGGAGAGAAGCCACGAAGGCTGCAAGAGAGGCG
                    ************************************************************

HsCD00333937        CTGTTGAGTTCTGCAGTTGATCATGGTTCCGATGAAGTTAAATTCCGTCAAGATTTAATG
NM_001198842.1      CTGTTGAGTTCTGCAGTTGATCATGGTTCCGATGAAGTTAAATTCCGTCAAGATTTAATG
NM_006431.2         CTGTTGAGTTCTGCAGTTGATCATGGTTCCGATGAAGTTAAATTCCGTCAAGATTTAATG
                    ************************************************************

HsCD00333937        AATATTGCGGGCACAACATTATCCTCAAAACTTCTTACTCATCACAAAGACCACTTTACA
NM_001198842.1      AATATTGCGGGCACAACATTATCCTCAAAACTTCTTACTCATCACAAAGACCACTTTACA
NM_006431.2         AATATTGCGGGCACAACATTATCCTCAAAACTTCTTACTCATCACAAAGACCACTTTACA
                    ************************************************************

HsCD00333937        AAGTTAGCTGTAGAAGCAGTTCTCAGACTGAAAGGCTCTGGCAACCTGGAGGCAATTCAT
NM_001198842.1      AAGTTAGCTGTAGAAGCAGTTCTCAGACTGAAAGGCTCTGGCAACCTGGAGGCAATTCAT
NM_006431.2         AAGTTAGCTGTAGAAGCAGTTCTCAGACTGAAAGGCTCTGGCAACCTGGAGGCAATTCAT
                    ************************************************************

HsCD00333937        ATTATCAAGAAGCTAGGAGGAAGTTTGGCAGATTCCTATTTAGATGAAGGCTTCCTGTTG
NM_001198842.1      ATTATCAAGAAGCTAGGAGGAAGTTTGGCAGATTCCTATTTAGATGAAGGCTTCCTGTTG
NM_006431.2         ATTATCAAGAAGCTAGGAGGAAGTTTGGCAGATTCCTATTTAGATGAAGGCTTCCTGTTG
                    ************************************************************

HsCD00333937        GATAAAAAAATTGGAGTAAATCAACCAAAACGAATTGAAAATGCTAAAATTCTTATTGCA
NM_001198842.1      GATAAAAAAATTGGAGTAAATCAACCAAAACGAATTGAAAATGCTAAAATTCTTATTGCA
NM_006431.2         GATAAAAAAATTGGAGTAAATCAACCAAAACGAATTGAAAATGCTAAAATTCTTATTGCA
                    ************************************************************

HsCD00333937        AATACTGGTATGGATACAGACAAAATAAAGATATTTGGTTCCCGGGTAAGAGTTGACTCT
NM_001198842.1      AATACTGGTATGGATACAGACAAAATAAAGATATTTGGTTCCCGGGTAAGAGTTGACTCT
NM_006431.2         AATACTGGTATGGATACAGACAAAATAAAGATATTTGGTTCCCGGGTAAGAGTTGACTCT
                    ************************************************************

HsCD00333937        ACAGCAAAGGTTGCAGAAATAGAACATGCGGAAAAGGAAAAAATGAAGGAGAAAGTTGAA
NM_001198842.1      ACAGCAAAGGTTGCAGAAATAGAACATGCGGAAAAGGAAAAAATGAAGGAGAAAGTTGAA
NM_006431.2         ACAGCAAAGGTTGCAGAAATAGAACATGCGGAAAAGGAAAAAATGAAGGAGAAAGTTGAA
                    ************************************************************

HsCD00333937        CGTATTCTTAAGCATGGAATAAATTGCTTTATTAACAGGCAATTAATTTATAATTATCCT
NM_001198842.1      CGTATTCTTAAGCATGGAATAAATTGCTTTATTAACAGGCAATTAATTTATAATTATCCT
NM_006431.2         CGTATTCTTAAGCATGGAATAAATTGCTTTATTAACAGGCAATTAATTTATAATTATCCT
                    ************************************************************

HsCD00333937        GAACAGCTCTTTGGTGCTGCTGGTGTCATGGCTATTGAGCATGCAGATTTTGCAGGTGTG
NM_001198842.1      GAACAGCTCTTTGGTGCTGCTGGTGTCATGGCTATTGAGCATGCAGATTTTGCAGGTGTG
NM_006431.2         GAACAGCTCTTTGGTGCTGCTGGTGTCATGGCTATTGAGCATGCAGATTTTGCAGGTGTG
                    ************************************************************

HsCD00333937        GAACGCCTAGCTCTTGTCACAGGTGGTGAAATTGCCTCTACCTTTGATCACCCAGAACTG
NM_001198842.1      GAACGCCTAGCTCTTGTCACAGGTGGTGAAATTGCCTCTACCTTTGATCACCCAGAACTG
NM_006431.2         GAACGCCTAGCTCTTGTCACAGGTGGTGAAATTGCCTCTACCTTTGATCACCCAGAACTG
                    ************************************************************

HsCD00333937        GTGAAGCTTGGAAGTTGCAAACTTATCGAGGAAGTCATGATTGGAGAAGACAAACTCATT
NM_001198842.1      GTGAAGCTTGGAAGTTGCAAACTTATCGAGGAAGTCATGATTGGAGAAGACAAACTCATT
NM_006431.2         GTGAAGCTTGGAAGTTGCAAACTTATCGAGGAAGTCATGATTGGAGAAGACAAACTCATT
                    ************************************************************

HsCD00333937        CACTTTTCTGGGGTTGCCCTTGGTGAGGCTTGTACCATTGTTTTGCGTGGTGCCACTCAA
NM_001198842.1      CACTTTTCTGGGGTTGCCCTTGGTGAGGCTTGTACCATTGTTTTGCGTGGTGCCACTCAA
NM_006431.2         CACTTTTCTGGGGTTGCCCTTGGTGAGGCTTGTACCATTGTTTTGCGTGGTGCCACTCAA
                    ************************************************************

HsCD00333937        CAAATTTTAGATGAAGCAGAAAGATCATTGCATGATGCTCTTTGTGTTCTTGCGCAAACT
NM_001198842.1      CAAATTTTAGATGAAGCAGAAAGATCATTGCATGATGCTCTTTGTGTTCTTGCGCAAACT
NM_006431.2         CAAATTTTAGATGAAGCAGAAAGATCATTGCATGATGCTCTTTGTGTTCTTGCGCAAACT
                    ************************************************************

HsCD00333937        GTAAAGGACTCTAGAACAGTTTATGGAGGAGGCTGTTCTGAGATGTTGATGGCTCATGCT
NM_001198842.1      GTAAAGGACTCTAGAACAGTTTATGGAGGAGGCTGTTCTGAGATGTTGATGGCTCATGCT
NM_006431.2         GTAAAGGACTCTAGAACAGTTTATGGAGGAGGCTGTTCTGAGATGTTGATGGCTCATGCT
                    ************************************************************

HsCD00333937        GTGACACAGCTTGCCAATAGAACACCAGGCAAAGAAGCTGTTGCAATGGAGTCTTATGCT
NM_001198842.1      GTGACACAGCTTGCCAATAGAACACCAGGCAAAGAAGCTGTTGCAATGGAGTCTTATGCT
NM_006431.2         GTGACACAGCTTGCCAATAGAACACCAGGCAAAGAAGCTGTTGCAATGGAGTCTTATGCT
                    ************************************************************

HsCD00333937        AAAGCACTGAGAATGTTGCCAACCATCATAGCTGACAATGCAGGCTATGACAGTGCAGAC
NM_001198842.1      AAAGCACTGAGAATGTTGCCAACCATCATAGCTGACAATGCAGGCTATGACAGTGCAGAC
NM_006431.2         AAAGCACTGAGAATGTTGCCAACCATCATAGCTGACAATGCAGGCTATGACAGTGCAGAC
                    ************************************************************

HsCD00333937        CTGGTGGCACAGCTCAGGGCTGCTCACAGTGAAGGCAATACCACTGCTGGATTGGATATG
NM_001198842.1      CTGGTGGCACAGCTCAGGGCTGCTCACAGTGAAGGCAATACCACTGCTGGATTGGATATG
NM_006431.2         CTGGTGGCACAGCTCAGGGCTGCTCACAGTGAAGGCAATACCACTGCTGGATTGGATATG
                    ************************************************************

HsCD00333937        AGGGAAGGCACCATTGGAGATATGGCTATCCTGGGTATAACAGAAAGTTTTCAAGTGAAG
NM_001198842.1      AGGGAAGGCACCATTGGAGATATGGCTATCCTGGGTATAACAGAAAGTTTTCAAGTGAAG
NM_006431.2         AGGGAAGGCACCATTGGAGATATGGCTATCCTGGGTATAACAGAAAGTTTTCAAGTGAAG
                    ************************************************************

HsCD00333937        CGACAGGTTCTTCTGAGTGCAGCTGAAGCAGCAGAGGTGATTCTGCGTGTGGACAACATC
NM_001198842.1      CGACAGGTTCTTCTGAGTGCAGCTGAAGCAGCAGAGGTGATTCTGCGTGTGGACAACATC
NM_006431.2         CGACAGGTTCTTCTGAGTGCAGCTGAAGCAGCAGAGGTGATTCTGCGTGTGGACAACATC
                    ************************************************************

HsCD00333937        ATCAAAGCGGCACCCAGGAAACGTGTCCCTGATCACCACGAAGGGCATCATCACCATCAC
NM_001198842.1      ATCAAAGCGGCACCCAGGAAACGTGTCCCTGATCACCACCCCTGTTAA------------
NM_006431.2         ATCAAAGCGGCACCCAGGAAACGTGTCCCTGATCACCACCCCTGTTAA------------
                    *************************************** .. *  *:            

HsCD00333937        CACTGA
NM_001198842.1      ------
NM_006431.2         ------
                          

Pathways

Reactome : Association of TriC/CCT with target proteins during biosynthesis
Reactome : Chaperonin-mediated protein folding
Reactome : Cooperation of Prefoldin and TriC/CCT in actin and tubulin folding
Reactome : Folding of actin by CCT/TriC
Reactome : Formation of tubulin folding intermediates by CCT/TriC
Reactome : Metabolism of proteins
Reactome : Prefoldin mediated transfer of substrate to CCT/TriC
Reactome : Protein folding

Protein

Structural Annotation Wiki : TOPSAN
UniProt : P78371
UniProt : B7ZAT2
HPRD : 06895

Clone

Cloning Information : 502747
HIP Master Clone ID : 413914
Original Clone ID : 13015a4BCt7p1

Experimental

TargetTrack - Experimental data : NYSGXRC-13015a

Organism


TAX_ID : 9606
Species Specific ID: 10576

Genome

Chromosome : 12
Map Location : 12q15
Ensembl : ENSG00000166226

Reagents

Labome : CCT2-antibody