DNASU Plasmid Repository • 480.965.5697 | Email

LGALS1 (Homo sapiens) in pMCSG7 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  LGALS1
Gene Name:  lectin, galactoside-binding, soluble, 1
Sequence             
Original Clone ID: NCI10533
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pMCSG7               Format:  CLOSED
Source: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
HsCD00343182

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 408nts         Open reading frame : 1 to 408
Reference Sequence Alignment

ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTG
CGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAAC
AACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTG
TGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTC
CAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAG
CTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTAC
ATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
g407a,*136*
                                

5' Linker Sequence:
TCCAATGCC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Confirmed
SolubleProtein: Protein_Confirmed
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG7

pMCSG7 in advanced viewed

Synonyms: pMCSG-7
Sequencing Primer: Forward:  T7short
Reverse:  T7 terminator
Description: Bacterial expresson vector with T7 promoter, adds N-terminal His tag and TEV protease site; amp resistance; ligation independent cloning (LIC).
Comments: pET21 derivative; for routine HTP purification
Size (bp): 5286
Parent Vector: None
Empty Vector: EvNO00084271
Properties: bacterial expression, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 12071693
Title: A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC ligation-independent cloning (LIC) region 204 235
bacterial origin ori ColE1 pBR322-type bacterial origin of replication 3280 3280
promoter T7 T7 promoter 360 376
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 335 357
repressor protein gene LacI LacI coding region 890 1849
selectable marker AmpR ampicillin resistance gene 4038 4898
tag His 2 N-terminal 6xHis tag 268 285
tag His C-terminal 6xHis tag 140 157
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : LGALS1
Symbol Nomenclature : LGALS1
SYNONYM : GAL1; GBP
Designation : 14 kDa laminin-binding protein|14 kDa lectin|HBL|HLBP14|HPL|S-Lac lectin 1|beta-galactoside-binding lectin L-14-I|beta-galactoside-binding protein 14kDa|gal-1|galaptin|galectin 1|galectin-1|lactose-binding lectin 1|putative MAPK-activating protein PM12
Full Nomenclature : lectin, galactoside-binding, soluble, 1
GENEID : 3956
GI : 12804557
GenBank Accession : BC001693
HGNC : 6561
MIM : 150570
Vega : OTTHUMG00000150661
Target GenBank: BC001693

 

Reference Sequence Alignment

  

HsCD00343182      ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTG
NM_002305.3       ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTG
                  ************************************************************

HsCD00343182      CGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAAC
NM_002305.3       CGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAAC
                  ************************************************************

HsCD00343182      AACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTG
NM_002305.3       AACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTG
                  ************************************************************

HsCD00343182      TGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTC
NM_002305.3       TGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTC
                  ************************************************************

HsCD00343182      CAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAG
NM_002305.3       CAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAG
                  ************************************************************

HsCD00343182      CTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTAC
NM_002305.3       CTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTAC
                  ************************************************************

HsCD00343182      ATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTAA
NM_002305.3       ATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGA
                  **********************************************.*

Pathways

NCI : Regulation of Ras family activation
NCI : Validated targets of C-MYC transcriptional repression

Protein

SMART domain : GLECT : Galectin
SMART domain : Gal-bind_lectin : Galactoside-binding lectin
UniProt : P09382
HPRD : 01040

Clone

Cloning Information : 562542
HIP Master Clone ID : 472860
Original Clone ID : NCI10533

Organism


TAX_ID : 9606
Species Specific ID: 3956

Genome

Chromosome : 22
Map Location : 22q13.1
Ensembl : ENSG00000100097

Reagents

Labome : galectin-antibody