DNASU Plasmid Repository • 480.965.5697 | Email

PRKAR2A (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRKAR2A
Gene Name:  protein kinase, cAMP-dependent, regulatory, type II, alpha
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH026677.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00003444

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1149nts         Open reading frame : 1 to 1149
Reference Sequence Alignment

ATGAGCCACATCCAGATCCCGCCGGGGCTCACGGAGCTGCTGCAGGGCTACACGGTGGAG
GTGCTGCGACAGCAGCCGCCTGACCTCGTCGAATTCGCAGTGGAGTACTTCACCCGCCTG
CGCGAGGCCCGCGCCCCAGCCTCAGTCCTGCCCGCCGCCACCCCACGCCAGAGCCTGGGC
CACCCCCCGCCAGAACCCGGCCCGGACCGTGTCGCCGACGCCAAAGGGGACAGCGAGTCG
GAGGAGGACGAGGACTTGGAAGTTCCAGTTCCTAGCAGATTTAATAGACGAGTATCAGTC
TGTGCTGAGACCTATAACCCTGATGAGGAAGAGGAAGATACAGATCCAAGGGTGATTCAT
CCTAAAACTGATGAACAGAGATGCAGACTTCAGGAAGCTTGCAAAGATATTCTCCTTTTC
AAAAATCTTGATCAGGAACAGCTTTCTCAAGTTCTCGATGCCATGTTTGAAAGGATAGTC
AAAGCTGATGAGCATGTCATTGACCAAGGAGATGATGGAGACAACTTTTATGTCATAGAA
CGGGGAACTTATGACATTTTAGTAACAAAAGATAATCAAACCCGCTCTGTTGGTCAATAT
GACAACCGTGGCAGTTTTGGAGAACTAGCTCTGATGTACAACACCCCGAGAGCTGCTACC
ATTGTTGCTACCTCAGAAGGCTCCCTTTGGGGACTGGACCGGGTGACTTTTAGAAGAATC
ATAGTGAAAAATAATGCAAAGAAGAGGAAGATGTTTGAATCATTTATTGAGTCTGTGCCC
CTCCTTAAATCACTAGAGGTGTCAGAACGAATGAAGATTGTGGATGTAATAGGAGAGAAG
ATCTATAAGGATGGAGAACGCATAATCACTCAGACTAAATCAAACAAGGATGGTGGGAAC
CAGGAGGTCGAGATTGCCCGCTGCCATAAGGGGCAGTACTTTGGAGAGCTTGCCCTGGTC
ACCAACAAACCCAGAGCTGCCTCAGCTTATGCAGTTGGAGATGTCAAATGCTTAGTTATG
GATGTACAAGCATTCGAGAGGCTTCTGGGGCCCTGCATGGACATCATGAAGAGGAACATC
TCACACTATGAGGAACAGCTGGTGAAGATGTTTGGCTCCAGCGTGGATCTGGGCAACCTC
GGGCAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1390
Start on reference sequence 242
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRKAR2A
Symbol Nomenclature : PRKAR2A
SYNONYM : PKR2; PRKAR2
Designation : cAMP-dependent protein kinase regulatory subunit RII alpha|cAMP-dependent protein kinase type II-alpha regulatory subunit|protein kinase A, RII-alpha subunit
Full Nomenclature : protein kinase, cAMP-dependent, regulatory, type II, alpha
GENEID : 5576
GI : 60652680
GenBank Accession : AY892118
HGNC : 9391
MIM : 176910
Vega : OTTHUMG00000133540
Target GenBank: BC002763

 

Reference Sequence Alignment

  

HsCD00003444        ATGAGCCACATCCAGATCCCGCCGGGGCTCACGGAGCTGCTGCAGGGCTACACGGTGGAG
NM_004157.2         ATGAGCCACATCCAGATCCCGCCGGGGCTCACGGAGCTGCTGCAGGGCTACACGGTGGAG
XM_005265313.1      ATGAGCCACATCCAGATCCCGCCGGGGCTCACGGAGCTGCTGCAGGGCTACACGGTGGAG
                    ************************************************************

HsCD00003444        GTGCTGCGACAGCAGCCGCCTGACCTCGTCGAATTCGCAGTGGAGTACTTCACCCGCCTG
NM_004157.2         GTGCTGCGACAGCAGCCGCCTGACCTCGTCGAATTCGCAGTGGAGTACTTCACCCGCCTG
XM_005265313.1      GTGCTGCGACAGCAGCCGCCTGACCTCGTCGAATTCGCAGTGGAGTACTTCACCCGCCTG
                    ************************************************************

HsCD00003444        CGCGAGGCCCGCGCCCCAGCCTCAGTCCTGCCCGCCGCCACCCCACGCCAGAGCCTGGGC
NM_004157.2         CGCGAGGCCCGCGCCCCAGCCTCAGTCCTGCCCGCCGCCACCCCACGCCAGAGCCTGGGC
XM_005265313.1      CGCGAGGCCCGCGCCCCAGCCTCAGTCCTGCCCGCCGCCACCCCACGCCAGAGCCTGGGC
                    ************************************************************

HsCD00003444        CACCCCCCGCCAGAACCCGGCCCGGACCGTGTCGCCGACGCCAAAGGGGACAGCGAGTCG
NM_004157.2         CACCCCCCGCCAGAACCCGGCCCGGACCGTGTCGCCGACGCCAAAGGGGACAGCGAGTCG
XM_005265313.1      CACCCCCCGCCAGAACCCGGCCCGGACCGTGTCGCCGACGCCAAAGGGGACAGCGAGTCG
                    ************************************************************

HsCD00003444        GAGGAGGACGAGGACTTGGAAGTTCCAGTTCCTAGCAGATTTAATAGACGAGTATCAGTC
NM_004157.2         GAGGAGGACGAGGACTTGGAAGTTCCAGTTCCTAGCAGATTTAATAGACGAGTATCAGTC
XM_005265313.1      GAGGAGGACGAGGACTTGGAAGTTCCAGTTCCTAGCAGATTTAATAGACGAGTATCAGTC
                    ************************************************************

HsCD00003444        TGTGCTGAGACCTATAACCCTGATGAGGAAGAGGAAGATACAGATCCAAGGGTGATTCAT
NM_004157.2         TGTGCTGAGACCTATAACCCTGATGAGGAAGAGGAAGATACAGATCCAAGGGTGATTCAT
XM_005265313.1      TGTGCTGAGACCTATAACCCTGATGAGGAAGAGGAAGATACAGATCCAAGGGTGATTCAT
                    ************************************************************

HsCD00003444        CCTAAAACTGATGAACAGAGATGCAGACTTCAGGAAGCTTGCAAAGATATTCTCCTTTTC
NM_004157.2         CCTAAAACTGATGAACAGAGATGCAGACTTCAGGAAGCTTGCAAAGATATTCTCCTTTTC
XM_005265313.1      CCTAAAACTGATGAACAGAGATGCAGACTTCAGGAAGCTTGCAAAGATATTCTCCTTTTC
                    ************************************************************

HsCD00003444        AAAAATCTTGATCAGGAACAGCTTTCTCAAGTTCTCGATGCCATGTTTGAAAGGATAGTC
NM_004157.2         AAAAATCTTGATCAGGAACAGCTTTCTCAAGTTCTCGATGCCATGTTTGAAAGGATAGTC
XM_005265313.1      AAAAATCTTGATCAGGAACAGCTTTCTCAAGTTCTCGATGCCATGTTTGAAAGGATAGTC
                    ************************************************************

HsCD00003444        AAAGCTGATGAGCATGTCATTGACCAAGGAGATGATGGAGACAACTTTTATGTCATAGAA
NM_004157.2         AAAGCTGATGAGCATGTCATTGACCAAGGAGATGATGGAGACAACTTTTATGTCATAGAA
XM_005265313.1      AAAGCTGATGAGCATGTCATTGACCAAGGAGATGATGGAGACAACTTTTATGTCATAGAA
                    ************************************************************

HsCD00003444        CGGGGAACTTATGACATTTTAGTAACAAAAGATAATCAAACCCGCTCTGTTGGTCAATAT
NM_004157.2         CGGGGAACTTATGACATTTTAGTAACAAAAGATAATCAAACCCGCTCTGTTGGTCAATAT
XM_005265313.1      CGGGGAACTTATGACATTTTAGTAACAAAAGATAATCAAACCCGCTCTGTTGGTCAATAT
                    ************************************************************

HsCD00003444        GACAACCGTGGCAGTTTTGGAGAACTAGCTCTGATGTACAACACCCCGAGAGCTGCTACC
NM_004157.2         GACAACCGTGGCAGTTTTGGAGAACTAGCTCTGATGTACAACACCCCGAGAGCTGCTACC
XM_005265313.1      GACAACCGTGGCAGTTTTGGAGAACTAGCTCTGATGTACAACACCCCGAGAGCTGCTACC
                    ************************************************************

HsCD00003444        ATTGTTGCTACCTCAGAAGGCTCCCTTTGGGGACTGGACCGGGTGACTTTTAGAAGAATC
NM_004157.2         ATTGTTGCTACCTCAGAAGGCTCCCTTTGGGGACTGGACCGGGTGACTTTTAGAAGAATC
XM_005265313.1      ATTGTTGCTACCTCAGAAGGCTCCCTTTGGGGACTGGACCGGGTGACTTTTAGAAGAATC
                    ************************************************************

HsCD00003444        ATAGTGAAAAATAATGCAAAGAAGAGGAAGATGTTTGAATCATTTATTGAGTCTGTGCCC
NM_004157.2         ATAGTGAAAAATAATGCAAAGAAGAGGAAGATGTTTGAATCATTTATTGAGTCTGTGCCC
XM_005265313.1      ATAGTGAAAAATAATGCAAAGAAGAGGAAGATGTTTGAATCATTTATTGAGTCTGTGCCC
                    ************************************************************

HsCD00003444        CTCCTTAAATCACTAGAGGTGTCAGAACGAATGAAGATTGTGGATGTAATAGGAGAGAAG
NM_004157.2         CTCCTTAAATCACTAGAGGTGTCAGAACGAATGAAGATTGTGGATGTAATAGGAGAGAAG
XM_005265313.1      CTCCTTAAATCACTAGAGGTGTCAGAACGAATGAAGATTGTGGATGTAATAGGAGAGAAG
                    ************************************************************

HsCD00003444        ATCTATAAGGATGGAGAACGCATAATCACTCAG---------------------------
NM_004157.2         ATCTATAAGGATGGAGAACGCATAATCACTCAGGGTGAAAAGGCTGATAGCTTTTACATC
XM_005265313.1      ATCTATAAGGATGGAGAACGCATAATCACTCAGGGTGAAAAGGCTGATAGCTTTTACATC
                    *********************************                           

HsCD00003444        ---------------------------------------ACTAAATCAAACAAGGATGGT
NM_004157.2         ATAGAGTCTGGCGAAGTGAGCATCTTGATTAGAAGCAGGACTAAATCAAACAAGGATGGT
XM_005265313.1      ATAGAGTCTGGCGAAGTGAGCATCTTGATTAGAAGCAGGACTAAATCAAACAAGGATGGT
                                                           *********************

HsCD00003444        GGGAACCAGGAGGTCGAGATTGCCCGCTGCCATAAGGGGCAGTACTTTGGAGAGCTTGCC
NM_004157.2         GGGAACCAGGAGGTCGAGATTGCCCGCTGCCATAAGGGGCAGTACTTTGGAGAGCTTGCC
XM_005265313.1      GGGAACCAGGAGGTCGAGATTGCCCGCTGCCATAAGGGGCAGTACTTTGGAGAGCTTGCC
                    ************************************************************

HsCD00003444        CTGGTCACCAACAAACCCAGAGCTGCCTCAGCTTATGCAGTTGGAGATGTCAAATGCTTA
NM_004157.2         CTGGTCACCAACAAACCCAGAGCTGCCTCAGCTTATGCAGTTGGAGATGTCAAATGCTTA
XM_005265313.1      CTGGTCACCAACAAACCCAGAGCTGCCTCAGCTTATGCAGTTGGAGATGTCAAATGCTTA
                    ************************************************************

HsCD00003444        GTTATGGATGTACAAGCATTCGAGAGGCTTCTGGGGCCCTGCATGGACATCATGAAGAGG
NM_004157.2         GTTATGGATGTACAAGCATTCGAGAGGCTTCTGGGGCCCTGCATGGACATCATGAAGAGG
XM_005265313.1      GTTATGGATGTACAAGCATTCGAGAGGCTTCTGGGGCCCTGCATGGACATCATGAAGAGG
                    ************************************************************

HsCD00003444        AACATCTCACACTATGAGGAACAGCTGGTGAAGATGTTTGGCTCCAGCGTGGATCTGGGC
NM_004157.2         AACATCTCACACTATGAGGAACAGCTGGTGAAGATGTTTGGCTCCAGCGTGGATCTGGGC
XM_005265313.1      AACATCTCACACTATGAGGAACAGCTGGTGAAGATGTTTGGCTCCAGCGTGGATCTGGGC
                    ************************************************************

HsCD00003444        AACCTCGGGCAGTTG
NM_004157.2         AACCTCGGGCAGTAG
XM_005265313.1      AACCTCGGGCAGTAG
                    *************:*

Pathways

Panther : 5HT1 type receptor mediated signaling pathway
Panther : Beta1 adrenergic receptor signaling pathway
Panther : Beta2 adrenergic receptor signaling pathway
Panther : Dopamine receptor mediated signaling pathway
Panther : Endothelin signaling pathway
Panther : Enkephalin release
Panther : GABA-B receptor II signaling
Panther : Hedgehog signaling pathway
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Histamine H2 receptor mediated signaling pathway
Panther : Metabotropic glutamate receptor group II pathway
Panther : Metabotropic glutamate receptor group III pathway
Panther : Muscarinic acetylcholine receptor 2 and 4 signaling pathway
Panther : Transcription regulation by bZIP transcription factor
Reactome : Aquaporin-mediated transport
Reactome : Ca-dependent events
Reactome : CaM pathway
Reactome : Calmodulin induced events
Reactome : DAG and IP3 signaling
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : DARPP-32 events
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : G-protein mediated events
Reactome : Glucagon signaling in metabolic regulation
Reactome : Glucagon-like Peptide-1 (GLP1) regulates insulin secretion
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Integration of energy metabolism
Reactome : Metabolism
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Opioid Signalling
Reactome : PKA activation
Reactome : PKA activation in glucagon signalling
Reactome : PKA-mediated phosphorylation of CREB
Reactome : PLC beta mediated events
Reactome : PLC-gamma1 signalling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Regulation of insulin secretion
Reactome : Regulation of water balance by renal Aquaporins
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signalling by NGF
Reactome : Transmembrane transport of small molecules
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : G Protein Signaling Pathways
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : TGF beta Signaling Pathway
WikiPathway : miRs in Muscle Cell Differentiation

Clone

Cloning Information : 26677
HIP Master Clone ID : 57053
Original Clone ID : FLH026677.01L

Organism


TAX_ID : 9606
Species Specific ID: 5576

Genome

Chromosome : 3
Map Location : 3p21.3-p21.2
Ensembl : ENSG00000114302

Reagents

Labome : PRKAR2A-antibody