DNASU Plasmid Repository • 480.965.5697 | Email

KLHL22 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  KLHL22
Gene Name:  kelch-like family member 22
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100000225)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00350969

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1902nts         Open reading frame : 1 to 1902
Reference Sequence Alignment

ATGGCAGAGGAGCAGGAGTTCACCCAGCTCTGCAAGTTGCCTGCACAGCCCTCACACCCA
CACTGCGTGAACAACACCTACCGCAGCGCACAGCACTCCCAGGCTCTGCTCCGAGGGCTG
CTGGCTCTCCGGGACAGCGGAATCCTCTTCGATGTTGTGCTGGTGGTGGAGGGCAGACAC
ATCGAGGCCCATCGCATCCTGCTGGCTGCGTCCTGCGATTACTTCAGAGGAATGTTTGCT
GGGGGATTGAAGGAGATGGAACAGGAAGAGGTCCTGATCCACGGTGTGTCCTACAATGCT
ATGTGCCAAATCCTACATTTCATATACACCTCCGAGCTGGAGCTCAGCCTGAGCAATGTA
CAAGAGACACTGGTGGCTGCCTGCCAGCTTCAGATCCCAGAAATTATCCATTTCTGCTGT
GATTTCCTCATGTCCTGGGTGGACGAAGAGAACATTCTCGATGTCTACCGGCTGGCAGAG
CTGTTTGACTTGAGCCGCCTGACTGAGCAACTGGACACCTATATCCTCAAAAACTTTGTG
GCCTTCTCTCGGACTGACAAGTACCGCCAGCTTCCATTGGAGAAGGTCTACTCCCTCCTC
AGCAGCAATCGCCTGGAGGTCTCCTGCGAGACCGAGGTATATGAGGGGGCCCTTCTCTAC
CATTATAGCCTGGAGCAGGTGCAGGCTGACCAGATCTCGCTGCACGAGCCCCCAAAGCTC
CTTGAGACAGTGCGGTTTCCGCTGATGGAAGCTGAGGTCCTGCAGCGGCTGCATGACAAG
CTGGACCCCAGCCCTTTGAGGGACACAGTGGCCAGCGCCCTCATGTACCACCGGAACGAG
AGCCTACAGCCCAGCCTGCAGAGCCCGCAAACGGAGCTGCGGTCGGACTTCCAGTGCGTT
GTGGGCTTCGGGGGCATTCACTCCACGCCGTCCACTGTCCTCAGCGACCAGGCCAAGTAT
CTAAACCCCTTACTGGGAGAGTGGAAGCACTTCACTGCCTCCCTGGCCCCCCGCATGTCC
AACCAGGGCATCGCGGTGCTCAACAACTTCGTATACTTGATTGGAGGGGACAACAATGTC
CAAGGATTTCGAGCAGAGTCCCGATGCTGGAGGTATGACCCACGGCACAACCGCTGGTTC
CAGATCCAGTCCCTGCAGCAGGAGCACGCCGACCTGTCCGTGTGTGTTGTAGGCAGGTAC
ATCTACGCTGTGGCGGGCCGTGACTACCACAATGACCTGAATGCTGTGGAGCGCTACGAC
CCTGCCACCAACTCCTGGGCATACGTGGCCCCACTCAAGAGGGAGGTGTATGCCCACGCA
GGCGCGACGCTGGAGGGGAAGATGTATATCACCTGCGGCCGCAGAGGGGAGGATTACCTG
AAAGAGACACACTGCTACGATCCAGGCAGCAACACTTGGCACACACTGGCTGATGGGCCT
GTGCGGCGCGCCTGGCACGGCATGGCAACCCTCCTCAACAAGCTGTATGTGATCGGGGGC
AGCAACAACGATGCCGGATACAGGAGGGACGTGCACCAGGTGGCCTGCTACAGCTGCACG
TCTGGACAGTGGTCATCTGTCTGCCCACTCCCTGCTGGGCACGGTGAGCCTGGCATTGCT
GTGCTGGACAACAGGATCTATGTGTTAGGTGGCCGCTCACACAACCGCGGCAGCCGCACA
GGCTACGTGCACATTTACGATGTGGAGAAGGACTGCTGGGAGGAAGGGCCCCAGCTGGAC
AACTCCATCTCAGGCCTGGCGGCCTGTGTGCTCACCCTGCCCCGCTCCCTGCTCCTTGAG
CCGCCCCGCGGGACCCCTGACCGCAGCCAGGCCGACCCGGACTTTGCCTCTGAGGTGATG
AGTGTGTCTGACTGGGAGGAGTTTGACAACTCCAGTGAGGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : KLHL22
Symbol Nomenclature : KLHL22
SYNONYM : KELCHL
Designation : kelch-like 22|kelch-like protein 22
Full Nomenclature : kelch-like family member 22
GENEID : 84861
GenBank Accession : 563576
HGNC : 25888
Vega : OTTHUMG00000150778
Target GenBank: CU013350

 

Reference Sequence Alignment

  

HsCD00350969      ATGGCAGAGGAGCAGGAGTTCACCCAGCTCTGCAAGTTGCCTGCACAGCCCTCACACCCA
NM_032775.3       ATGGCAGAGGAGCAGGAGTTCACCCAGCTCTGCAAGTTGCCTGCACAGCCCTCACACCCA
                  ************************************************************

HsCD00350969      CACTGCGTGAACAACACCTACCGCAGCGCACAGCACTCCCAGGCTCTGCTCCGAGGGCTG
NM_032775.3       CACTGCGTGAACAACACCTACCGCAGCGCACAGCACTCCCAGGCTCTGCTCCGAGGGCTG
                  ************************************************************

HsCD00350969      CTGGCTCTCCGGGACAGCGGAATCCTCTTCGATGTTGTGCTGGTGGTGGAGGGCAGACAC
NM_032775.3       CTGGCTCTCCGGGACAGCGGAATCCTCTTCGATGTTGTGCTGGTGGTGGAGGGCAGACAC
                  ************************************************************

HsCD00350969      ATCGAGGCCCATCGCATCCTGCTGGCTGCGTCCTGCGATTACTTCAGAGGAATGTTTGCT
NM_032775.3       ATCGAGGCCCATCGCATCCTGCTGGCTGCGTCCTGCGATTACTTCAGAGGAATGTTTGCT
                  ************************************************************

HsCD00350969      GGGGGATTGAAGGAGATGGAACAGGAAGAGGTCCTGATCCACGGTGTGTCCTACAATGCT
NM_032775.3       GGGGGATTGAAGGAGATGGAACAGGAAGAGGTCCTGATCCACGGTGTGTCCTACAATGCT
                  ************************************************************

HsCD00350969      ATGTGCCAAATCCTACATTTCATATACACCTCCGAGCTGGAGCTCAGCCTGAGCAATGTA
NM_032775.3       ATGTGCCAAATCCTACATTTCATATACACCTCCGAGCTGGAGCTCAGCCTGAGCAATGTA
                  ************************************************************

HsCD00350969      CAAGAGACACTGGTGGCTGCCTGCCAGCTTCAGATCCCAGAAATTATCCATTTCTGCTGT
NM_032775.3       CAAGAGACACTGGTGGCTGCCTGCCAGCTTCAGATCCCAGAAATTATCCATTTCTGCTGT
                  ************************************************************

HsCD00350969      GATTTCCTCATGTCCTGGGTGGACGAAGAGAACATTCTCGATGTCTACCGGCTGGCAGAG
NM_032775.3       GATTTCCTCATGTCCTGGGTGGACGAAGAGAACATTCTCGATGTCTACCGGCTGGCAGAG
                  ************************************************************

HsCD00350969      CTGTTTGACTTGAGCCGCCTGACTGAGCAACTGGACACCTATATCCTCAAAAACTTTGTG
NM_032775.3       CTGTTTGACTTGAGCCGCCTGACTGAGCAACTGGACACCTATATCCTCAAAAACTTTGTG
                  ************************************************************

HsCD00350969      GCCTTCTCTCGGACTGACAAGTACCGCCAGCTTCCATTGGAGAAGGTCTACTCCCTCCTC
NM_032775.3       GCCTTCTCTCGGACTGACAAGTACCGCCAGCTTCCATTGGAGAAGGTCTACTCCCTCCTC
                  ************************************************************

HsCD00350969      AGCAGCAATCGCCTGGAGGTCTCCTGCGAGACCGAGGTATATGAGGGGGCCCTTCTCTAC
NM_032775.3       AGCAGCAATCGCCTGGAGGTCTCCTGCGAGACCGAGGTATATGAGGGGGCCCTTCTCTAC
                  ************************************************************

HsCD00350969      CATTATAGCCTGGAGCAGGTGCAGGCTGACCAGATCTCGCTGCACGAGCCCCCAAAGCTC
NM_032775.3       CATTATAGCCTGGAGCAGGTGCAGGCTGACCAGATCTCGCTGCACGAGCCCCCAAAGCTC
                  ************************************************************

HsCD00350969      CTTGAGACAGTGCGGTTTCCGCTGATGGAAGCTGAGGTCCTGCAGCGGCTGCATGACAAG
NM_032775.3       CTTGAGACAGTGCGGTTTCCGCTGATGGAAGCTGAGGTCCTGCAGCGGCTGCATGACAAG
                  ************************************************************

HsCD00350969      CTGGACCCCAGCCCTTTGAGGGACACAGTGGCCAGCGCCCTCATGTACCACCGGAACGAG
NM_032775.3       CTGGACCCCAGCCCTTTGAGGGACACAGTGGCCAGCGCCCTCATGTACCACCGGAACGAG
                  ************************************************************

HsCD00350969      AGCCTACAGCCCAGCCTGCAGAGCCCGCAAACGGAGCTGCGGTCGGACTTCCAGTGCGTT
NM_032775.3       AGCCTACAGCCCAGCCTGCAGAGCCCGCAAACGGAGCTGCGGTCGGACTTCCAGTGCGTT
                  ************************************************************

HsCD00350969      GTGGGCTTCGGGGGCATTCACTCCACGCCGTCCACTGTCCTCAGCGACCAGGCCAAGTAT
NM_032775.3       GTGGGCTTCGGGGGCATTCACTCCACGCCGTCCACTGTCCTCAGCGACCAGGCCAAGTAT
                  ************************************************************

HsCD00350969      CTAAACCCCTTACTGGGAGAGTGGAAGCACTTCACTGCCTCCCTGGCCCCCCGCATGTCC
NM_032775.3       CTAAACCCCTTACTGGGAGAGTGGAAGCACTTCACTGCCTCCCTGGCCCCCCGCATGTCC
                  ************************************************************

HsCD00350969      AACCAGGGCATCGCGGTGCTCAACAACTTCGTATACTTGATTGGAGGGGACAACAATGTC
NM_032775.3       AACCAGGGCATCGCGGTGCTCAACAACTTCGTATACTTGATTGGAGGGGACAACAATGTC
                  ************************************************************

HsCD00350969      CAAGGATTTCGAGCAGAGTCCCGATGCTGGAGGTATGACCCACGGCACAACCGCTGGTTC
NM_032775.3       CAAGGATTTCGAGCAGAGTCCCGATGCTGGAGGTATGACCCACGGCACAACCGCTGGTTC
                  ************************************************************

HsCD00350969      CAGATCCAGTCCCTGCAGCAGGAGCACGCCGACCTGTCCGTGTGTGTTGTAGGCAGGTAC
NM_032775.3       CAGATCCAGTCCCTGCAGCAGGAGCACGCCGACCTGTCCGTGTGTGTTGTAGGCAGGTAC
                  ************************************************************

HsCD00350969      ATCTACGCTGTGGCGGGCCGTGACTACCACAATGACCTGAATGCTGTGGAGCGCTACGAC
NM_032775.3       ATCTACGCTGTGGCGGGCCGTGACTACCACAATGACCTGAATGCTGTGGAGCGCTACGAC
                  ************************************************************

HsCD00350969      CCTGCCACCAACTCCTGGGCATACGTGGCCCCACTCAAGAGGGAGGTGTATGCCCACGCA
NM_032775.3       CCTGCCACCAACTCCTGGGCATACGTGGCCCCACTCAAGAGGGAGGTGTATGCCCACGCA
                  ************************************************************

HsCD00350969      GGCGCGACGCTGGAGGGGAAGATGTATATCACCTGCGGCCGCAGAGGGGAGGATTACCTG
NM_032775.3       GGCGCGACGCTGGAGGGGAAGATGTATATCACCTGCGGCCGCAGAGGGGAGGATTACCTG
                  ************************************************************

HsCD00350969      AAAGAGACACACTGCTACGATCCAGGCAGCAACACTTGGCACACACTGGCTGATGGGCCT
NM_032775.3       AAAGAGACACACTGCTACGATCCAGGCAGCAACACTTGGCACACACTGGCTGATGGGCCT
                  ************************************************************

HsCD00350969      GTGCGGCGCGCCTGGCACGGCATGGCAACCCTCCTCAACAAGCTGTATGTGATCGGGGGC
NM_032775.3       GTGCGGCGCGCCTGGCACGGCATGGCAACCCTCCTCAACAAGCTGTATGTGATCGGGGGC
                  ************************************************************

HsCD00350969      AGCAACAACGATGCCGGATACAGGAGGGACGTGCACCAGGTGGCCTGCTACAGCTGCACG
NM_032775.3       AGCAACAACGATGCCGGATACAGGAGGGACGTGCACCAGGTGGCCTGCTACAGCTGCACG
                  ************************************************************

HsCD00350969      TCTGGACAGTGGTCATCTGTCTGCCCACTCCCTGCTGGGCACGGTGAGCCTGGCATTGCT
NM_032775.3       TCTGGACAGTGGTCATCTGTCTGCCCACTCCCTGCTGGGCACGGTGAGCCTGGCATTGCT
                  ************************************************************

HsCD00350969      GTGCTGGACAACAGGATCTATGTGTTAGGTGGCCGCTCACACAACCGCGGCAGCCGCACA
NM_032775.3       GTGCTGGACAACAGGATCTATGTGTTAGGTGGCCGCTCACACAACCGCGGCAGCCGCACA
                  ************************************************************

HsCD00350969      GGCTACGTGCACATTTACGATGTGGAGAAGGACTGCTGGGAGGAAGGGCCCCAGCTGGAC
NM_032775.3       GGCTACGTGCACATTTACGATGTGGAGAAGGACTGCTGGGAGGAAGGGCCCCAGCTGGAC
                  ************************************************************

HsCD00350969      AACTCCATCTCAGGCCTGGCGGCCTGTGTGCTCACCCTGCCCCGCTCCCTGCTCCTTGAG
NM_032775.3       AACTCCATCTCAGGCCTGGCGGCCTGTGTGCTCACCCTGCCCCGCTCCCTGCTCCTTGAG
                  ************************************************************

HsCD00350969      CCGCCCCGCGGGACCCCTGACCGCAGCCAGGCCGACCCGGACTTTGCCTCTGAGGTGATG
NM_032775.3       CCGCCCCGCGGGACCCCTGACCGCAGCCAGGCCGACCCGGACTTTGCCTCTGAGGTGATG
                  ************************************************************

HsCD00350969      AGTGTGTCTGACTGGGAGGAGTTTGACAACTCCAGTGAGGAC---
NM_032775.3       AGTGTGTCTGACTGGGAGGAGTTTGACAACTCCAGTGAGGACTAG
                  ******************************************   

Protein

SMART domain : Kelch :
SMART domain : BACK : BTB And C-terminal Kelch
SMART domain : BTB : Broad-Complex, Tramtrack and Bric a brac
UniProt : Q53GT1
HPRD : 07858

Clone

Cloning Information : 563576

Organism


TAX_ID : 9606
Species Specific ID: 84861

Genome

Chromosome : 22
Map Location : 22q11.21
Ensembl : ENSG00000099910

Reagents

Labome : KLHL22-antibody