DNASU Plasmid Repository • 480.965.5697 | Email

SNAP29 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SNAP29
Gene Name:  synaptosomal-associated protein, 29kDa
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100000439)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00351147

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 774nts         Open reading frame : 1 to 774
Reference Sequence Alignment

ATGTCAGCTTACCCTAAAAGCTACAATCCGTTCGACGACGACGGGGAGGACGAAGGCGCC
CGGCCGGCCCCTTGGAGGGACGCCCGAGACCTCCCCGACGGGCCCGACGCGCCCGCGGAC
AGGCAGCAGTACTTGCGGCAGGAGGTCCTCCGCAGGGCTGAGGCCACGGCCGCCAGCACC
AGCAGGTCCCTGGCCCTCATGTACGAGTCCGAGAAGGTTGGGGTCGCCTCTTCCGAGGAG
CTCGCCCGTCAGCGAGGAGTCCTGGAGCGCACAGAGAAGATGGTGGACAAGATGGACCAA
GATTTGAAGATCAGCCAGAAACACATCAATAGCATTAAGAGCGTGTTTGGGGGGCTGGTC
AATTACTTCAAATCCAAACCAGTAGAGACCCCACCTGAACAGAATGGCACCCTCACCTCC
CAGCCCAACAACAGATTGAAAGAAGCTATAAGTACAAGTAAAGAACAGGAAGCAAAGTAC
CAGGCCAGCCACCCAAACCTTAGAAAGCTGGATGATACAGACCCTGTCCCCAGAGGGGCT
GGTTCTGCCATGAGTACTGATGCTTACCCAAAGAACCCACACCTTCGAGCCTATCACCAG
AAGATCGACAGCAACCTAGATGAGCTGTCCATGGGACTGGGTCGTCTGAAGGACATAGCC
CTGGGGATGCAGACAGAAATTGAGGAGCAAGATGACATTCTTGACCGGCTGACAACCAAA
GTGGACAAGTTAGATGTCAACATAAAAAGCACAGAAAGAAAAGTTCGACAACTC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SNAP29
Symbol Nomenclature : SNAP29
SYNONYM : CEDNIK; SNAP-29
Designation : soluble 29 kDa NSF attachment protein|synaptosomal-associated protein 29|vesicle-membrane fusion protein SNAP-29
Full Nomenclature : synaptosomal-associated protein, 29kDa
GENEID : 9342
GenBank Accession : 563754
HGNC : 11133
MIM : 604202
Vega : OTTHUMG00000150765
Target GenBank: CU013469

 

Reference Sequence Alignment

  

HsCD00351147      ATGTCAGCTTACCCTAAAAGCTACAATCCGTTCGACGACGACGGGGAGGACGAAGGCGCC
NM_004782.3       ATGTCAGCTTACCCTAAAAGCTACAATCCGTTCGACGACGACGGGGAGGACGAAGGCGCC
                  ************************************************************

HsCD00351147      CGGCCGGCCCCTTGGAGGGACGCCCGAGACCTCCCCGACGGGCCCGACGCGCCCGCGGAC
NM_004782.3       CGGCCGGCCCCTTGGAGGGACGCCCGAGACCTCCCCGACGGGCCCGACGCGCCCGCGGAC
                  ************************************************************

HsCD00351147      AGGCAGCAGTACTTGCGGCAGGAGGTCCTCCGCAGGGCTGAGGCCACGGCCGCCAGCACC
NM_004782.3       AGGCAGCAGTACTTGCGGCAGGAGGTCCTCCGCAGGGCTGAGGCCACGGCCGCCAGCACC
                  ************************************************************

HsCD00351147      AGCAGGTCCCTGGCCCTCATGTACGAGTCCGAGAAGGTTGGGGTCGCCTCTTCCGAGGAG
NM_004782.3       AGCAGGTCCCTGGCCCTCATGTACGAGTCCGAGAAGGTTGGGGTCGCCTCTTCCGAGGAG
                  ************************************************************

HsCD00351147      CTCGCCCGTCAGCGAGGAGTCCTGGAGCGCACAGAGAAGATGGTGGACAAGATGGACCAA
NM_004782.3       CTCGCCCGTCAGCGAGGAGTCCTGGAGCGCACAGAGAAGATGGTGGACAAGATGGACCAA
                  ************************************************************

HsCD00351147      GATTTGAAGATCAGCCAGAAACACATCAATAGCATTAAGAGCGTGTTTGGGGGGCTGGTC
NM_004782.3       GATTTGAAGATCAGCCAGAAACACATCAATAGCATTAAGAGCGTGTTTGGGGGGCTGGTC
                  ************************************************************

HsCD00351147      AATTACTTCAAATCCAAACCAGTAGAGACCCCACCTGAACAGAATGGCACCCTCACCTCC
NM_004782.3       AATTACTTCAAATCCAAACCAGTAGAGACCCCACCTGAACAGAATGGCACCCTCACCTCC
                  ************************************************************

HsCD00351147      CAGCCCAACAACAGATTGAAAGAAGCTATAAGTACAAGTAAAGAACAGGAAGCAAAGTAC
NM_004782.3       CAGCCCAACAACAGATTGAAAGAAGCTATAAGTACAAGTAAAGAACAGGAAGCAAAGTAC
                  ************************************************************

HsCD00351147      CAGGCCAGCCACCCAAACCTTAGAAAGCTGGATGATACAGACCCTGTCCCCAGAGGGGCT
NM_004782.3       CAGGCCAGCCACCCAAACCTTAGAAAGCTGGATGATACAGACCCTGTCCCCAGAGGGGCT
                  ************************************************************

HsCD00351147      GGTTCTGCCATGAGTACTGATGCTTACCCAAAGAACCCACACCTTCGAGCCTATCACCAG
NM_004782.3       GGTTCTGCCATGAGTACTGATGCTTACCCAAAGAACCCACACCTTCGAGCCTATCACCAG
                  ************************************************************

HsCD00351147      AAGATCGACAGCAACCTAGATGAGCTGTCCATGGGACTGGGTCGTCTGAAGGACATAGCC
NM_004782.3       AAGATCGACAGCAACCTAGATGAGCTGTCCATGGGACTGGGTCGTCTGAAGGACATAGCC
                  ************************************************************

HsCD00351147      CTGGGGATGCAGACAGAAATTGAGGAGCAAGATGACATTCTTGACCGGCTGACAACCAAA
NM_004782.3       CTGGGGATGCAGACAGAAATTGAGGAGCAAGATGACATTCTTGACCGGCTGACAACCAAA
                  ************************************************************

HsCD00351147      GTGGACAAGTTAGATGTCAACATAAAAAGCACAGAAAGAAAAGTTCGACAACTC---
NM_004782.3       GTGGACAAGTTAGATGTCAACATAAAAAGCACAGAAAGAAAAGTTCGACAACTCTGA
                  ******************************************************   

Pathways

Panther : 5HT1 type receptor mediated signaling pathway
Panther : 5HT2 type receptor mediated signaling pathway
Panther : 5HT3 type receptor mediated signaling pathway
Panther : 5HT4 type receptor mediated signaling pathway
Panther : Adrenaline and noradrenaline biosynthesis
Panther : Beta1 adrenergic receptor signaling pathway
Panther : Beta2 adrenergic receptor signaling pathway
Panther : Beta3 adrenergic receptor signaling pathway
Panther : Cortocotropin releasing factor receptor signaling pathway
Panther : Dopamine receptor mediated signaling pathway
Panther : Ionotropic glutamate receptor pathway
Panther : Metabotropic glutamate receptor group II pathway
Panther : Metabotropic glutamate receptor group III pathway
Panther : Muscarinic acetylcholine receptor 1 and 3 signaling pathway
Panther : Muscarinic acetylcholine receptor 2 and 4 signaling pathway
Panther : Nicotinic acetylcholine receptor signaling pathway
Panther : Opioid prodynorphin pathway
Panther : Opioid proenkephalin pathway
Panther : Opioid proopiomelanocortin pathway
Panther : Oxytocin receptor mediated signaling pathway
Panther : Thyrotropin-releasing hormone receptor signaling pathway
WikiPathway : Epithelium TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase

Protein

SMART domain : t_SNARE : Helical region found in SNAREs
UniProt : O95721
HPRD : 11968

Clone

Cloning Information : 563754

Organism


TAX_ID : 9606
Species Specific ID: 9342

Genome

Chromosome : 22
Map Location : 22q11.21
Ensembl : ENSG00000099940

Reagents

Labome : SNAP29-antibody