DNASU Plasmid Repository • 480.965.5697 | Email

CAPN3 (Homo sapiens) in pENTR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CAPN3
Gene Name:  calpain 3, (p94)
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR221               Format:  CLOSED
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100067119)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00351574

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 930nts         Open reading frame : 1 to 930
Reference Sequence Alignment

ATGCACGGGAACAAGCAGCACCTGCAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCC
AGGAGCAAAACCTACATCAACATGCGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGC
GAGTACGTCATCGTGCCCTCCACCTACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGG
GTCTTCTCTGAAAAGAGGAACCTCTCTGAGGAAGTTGAAAATACCATCTCCGTGGATCGG
CCAGTGAAAAAGAAAAAAACCAAGCCCATCATCTTCGTTTCGGACAGAGCAAACAGCAAC
AAGGAGCTGGGTGTGGACCAGGAGTCAGAGGAGGGCAAAGGCAAAACAAGCCCTGATAAG
CAAAAGCAGTCCCCACAGCCACAGCCTGGCAGCTCTGATCAGGAAAGTGAGGAACAGCAA
CAATTCCGGAACATTTTCAAGCAGATAGCAGGAGATGACATGGAGATCTGTGCAGATGAG
CTCAAGAAGGTCCTTAACACAGTCGTGAACAAACACAAGGACCTGAAGACACACGGGTTC
ACACTGGAGTCCTGCCGTAGCATGATTGCGCTCATGGATACAGATGGCTCTGGAAAGCTC
AACCTGCAGGAGTTCCACCACCTCTGGAACAAGATTAAGGCCTGGCAGAAAATTTTCAAA
CACTATGACACAGACCAGTCCGGCACCATCAACAGCTACGAGATGCGAAATGCAGTCAAC
GACGCAGGATTCCACCTCAACAACCAGCTCTATGACATCATTACCATGCGGTACGCAGAC
AAACACATGAACATCGACTTTGACAGTTTCATCTGCTGCTTCGTTAGGCTGGAGGGCATG
TTCAGAGCTTTTCATGCATTTGACAAGGATGGAGATGGTATCATCAAGCTCAACGTTCTG
GAGTGGCTGCAGCTCACCATGTATGCCTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR221

pENTR221 in advanced viewed

Synonyms: pDONR221, pENTR221-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; kanamycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php.
Size (bp): 2574
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 1905 4
primer site M13 F M13 forward priming site 846 865
primer site M13 Rev M13 reverse primer site 846 865
recombination site rrnBT2 rrnB T2 transcription termination sequence 275 302
recombination site rrnBT1 rrnB T1 transcription termination sequence 434 477
recombination site attL1 attL1 recombination site 575 675
recombination site attL2 attL2 recombination site 805 706
selectable marker KanR kanamycin resistance gene 975 1784

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CAPN3
Symbol Nomenclature : CAPN3
SYNONYM : CANP3; CANPL3; LGMD2; LGMD2A; nCL-1; p94
Designation : calcium-activated neutral proteinase 3|calpain L3|calpain p94, large [catalytic] subunit|calpain, large polypeptide L3|calpain-3|muscle-specific calcium-activated neutral protease 3 large subunit|new calpain 1
Full Nomenclature : calpain 3, (p94)
GENEID : 825
GenBank Accession : 564181
HGNC : 1480
MIM : 114240
Vega : OTTHUMG00000130619
Target GenBank: EU832090

 

Reference Sequence Alignment

  

HsCD00351574      ------------------------------------------------------------
NM_000070.2       ATGCCGACCGTCATTAGCGCATCTGTGGCTCCAAGGACAGCGGCTGAGCCCCGGTCCCCA
NM_024344.1       ATGCCGACCGTCATTAGCGCATCTGTGGCTCCAAGGACAGCGGCTGAGCCCCGGTCCCCA
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       GGGCCAGTTCCTCACCCGGCCCAGAGCAAGGCCACTGAGGCTGGGGGTGGAAACCCAAGT
NM_024344.1       GGGCCAGTTCCTCACCCGGCCCAGAGCAAGGCCACTGAGGCTGGGGGTGGAAACCCAAGT
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       GGCATCTATTCAGCCATCATCAGCCGCAATTTTCCTATTATCGGAGTGAAAGAGAAGACA
NM_024344.1       GGCATCTATTCAGCCATCATCAGCCGCAATTTTCCTATTATCGGAGTGAAAGAGAAGACA
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       TTCGAGCAACTTCACAAGAAATGTCTAGAAAAGAAAGTTCTTTATGTGGACCCTGAGTTC
NM_024344.1       TTCGAGCAACTTCACAAGAAATGTCTAGAAAAGAAAGTTCTTTATGTGGACCCTGAGTTC
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       CCACCGGATGAGACCTCTCTCTTTTATAGCCAGAAGTTCCCCATCCAGTTCGTCTGGAAG
NM_024344.1       CCACCGGATGAGACCTCTCTCTTTTATAGCCAGAAGTTCCCCATCCAGTTCGTCTGGAAG
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       AGACCTCCGGAAATTTGCGAGAATCCCCGATTTATCATTGATGGAGCCAACAGAACTGAC
NM_024344.1       AGACCTCCGGAAATTTGCGAGAATCCCCGATTTATCATTGATGGAGCCAACAGAACTGAC
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       ATCTGTCAAGGAGAGCTAGGGGACTGCTGGTTTCTCGCAGCCATTGCCTGCCTGACCCTG
NM_024344.1       ATCTGTCAAGGAGAGCTAGGGGACTGCTGGTTTCTCGCAGCCATTGCCTGCCTGACCCTG
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       AACCAGCACCTTCTTTTCCGAGTCATACCCCATGATCAAAGTTTCATCGAAAACTACGCA
NM_024344.1       AACCAGCACCTTCTTTTCCGAGTCATACCCCATGATCAAAGTTTCATCGAAAACTACGCA
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       GGGATCTTCCACTTCCAGTTCTGGCGCTATGGAGAGTGGGTGGACGTGGTTATAGATGAC
NM_024344.1       GGGATCTTCCACTTCCAGTTCTGGCGCTATGGAGAGTGGGTGGACGTGGTTATAGATGAC
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       TGCCTGCCAACGTACAACAATCAACTGGTTTTCACCAAGTCCAACCACCGCAATGAGTTC
NM_024344.1       TGCCTGCCAACGTACAACAATCAACTGGTTTTCACCAAGTCCAACCACCGCAATGAGTTC
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       TGGAGTGCTCTGCTGGAGAAGGCTTATGCTAAGCTCCATGGTTCCTACGAAGCTCTGAAA
NM_024344.1       TGGAGTGCTCTGCTGGAGAAGGCTTATGCTAAGCTCCATGGTTCCTACGAAGCTCTGAAA
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       GGTGGGAACACCACAGAGGCCATGGAGGACTTCACAGGAGGGGTGGCAGAGTTTTTTGAG
NM_024344.1       GGTGGGAACACCACAGAGGCCATGGAGGACTTCACAGGAGGGGTGGCAGAGTTTTTTGAG
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       ATCAGGGATGCTCCTAGTGACATGTACAAGATCATGAAGAAAGCCATCGAGAGAGGCTCC
NM_024344.1       ATCAGGGATGCTCCTAGTGACATGTACAAGATCATGAAGAAAGCCATCGAGAGAGGCTCC
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       CTCATGGGCTGCTCCATTGATGATGGCACGAACATGACCTATGGAACCTCTCCTTCTGGT
NM_024344.1       CTCATGGGCTGCTCCATTGATGATGGCACGAACATGACCTATGGAACCTCTCCTTCTGGT
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       CTGAACATGGGGGAGTTGATTGCACGGATGGTAAGGAATATGGATAACTCACTGCTCCAG
NM_024344.1       CTGAACATGGGGGAGTTGATTGCACGGATGGTAAGGAATATGGATAACTCACTGCTCCAG
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       GACTCAGACCTCGACCCCAGAGGCTCAGATGAAAGACCGACCCGGACAATCATTCCGGTT
NM_024344.1       GACTCAGACCTCGACCCCAGAGGCTCAGATGAAAGACCGACCCGGACAATCATTCCGGTT
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       CAGTATGAGACAAGAATGGCCTGCGGGCTGGTCAGAGGTCACGCCTACTCTGTCACGGGG
NM_024344.1       CAGTATGAGACAAGAATGGCCTGCGGGCTGGTCAGAGGTCACGCCTACTCTGTCACGGGG
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       CTGGATGAGGTCCCGTTCAAAGGTGAGAAAGTGAAGCTGGTGCGGCTGCGGAATCCGTGG
NM_024344.1       CTGGATGAGGTCCCGTTCAAAGGTGAGAAAGTGAAGCTGGTGCGGCTGCGGAATCCGTGG
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       GGCCAGGTGGAGTGGAACGGTTCTTGGAGTGATAGATGGAAGGACTGGAGCTTTGTGGAC
NM_024344.1       GGCCAGGTGGAGTGGAACGGTTCTTGGAGTGATAGATGGAAGGACTGGAGCTTTGTGGAC
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       AAAGATGAGAAGGCCCGTCTGCAGCACCAGGTCACTGAGGATGGAGAGTTCTGGATGTCC
NM_024344.1       AAAGATGAGAAGGCCCGTCTGCAGCACCAGGTCACTGAGGATGGAGAGTTCTGGATGTCC
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       TATGAGGATTTCATCTACCATTTCACAAAGTTGGAGATCTGCAACCTCACGGCCGATGCT
NM_024344.1       TATGAGGATTTCATCTACCATTTCACAAAGTTGGAGATCTGCAACCTCACGGCCGATGCT
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       CTGCAGTCTGACAAGCTTCAGACCTGGACAGTGTCTGTGAACGAGGGCCGCTGGGTACGG
NM_024344.1       CTGCAGTCTGACAAGCTTCAGACCTGGACAGTGTCTGTGAACGAGGGCCGCTGGGTACGG
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       GGTTGCTCTGCCGGAGGCTGCCGCAACTTCCCAGATACTTTCTGGACCAACCCTCAGTAC
NM_024344.1       GGTTGCTCTGCCGGAGGCTGCCGCAACTTCCCAGATACTTTCTGGACCAACCCTCAGTAC
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       CGTCTGAAGCTCCTGGAGGAGGACGATGACCCTGATGACTCGGAGGTGATTTGCAGCTTC
NM_024344.1       CGTCTGAAGCTCCTGGAGGAGGACGATGACCCTGATGACTCGGAGGTGATTTGCAGCTTC
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------------------------------
NM_000070.2       CTGGTGGCCCTGATGCAGAAGAACCGGCGGAAGGACCGGAAGCTAGGGGCCAGTCTCTTC
NM_024344.1       CTGGTGGCCCTGATGCAGAAGAACCGGCGGAAGGACCGGAAGCTAGGGGCCAGTCTCTTC
NM_173088.1       ------------------------------------------------------------
                                                                              

HsCD00351574      ------------------------------------ATGCACGGGAACAAGCAGCACCTG
NM_000070.2       ACCATTGGCTTCGCCATCTACGAGGTTCCCAAAGAGATGCACGGGAACAAGCAGCACCTG
NM_024344.1       ACCATTGGCTTCGCCATCTACGAGGTTCCCAAAGAGATGCACGGGAACAAGCAGCACCTG
NM_173088.1       ------------------------------------ATGCACGGGAACAAGCAGCACCTG
                                                      ************************

HsCD00351574      CAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGCAAAACCTACATCAACATG
NM_000070.2       CAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGCAAAACCTACATCAACATG
NM_024344.1       CAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGCAAAACCTACATCAACATG
NM_173088.1       CAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGCAAAACCTACATCAACATG
                  ************************************************************

HsCD00351574      CGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCCCTCCACC
NM_000070.2       CGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCCCTCCACC
NM_024344.1       CGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCCCTCCACC
NM_173088.1       CGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCCCTCCACC
                  ************************************************************

HsCD00351574      TACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGGGTCTTCTCTGAAAAGAGGAACCTC
NM_000070.2       TACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGGGTCTTCTCTGAAAAGAGGAACCTC
NM_024344.1       TACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGGGTCTTCTCTGAAAAGAGGAACCTC
NM_173088.1       TACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGGGTCTTCTCTGAAAAGAGGAACCTC
                  ************************************************************

HsCD00351574      TCTGAGGAAGTTGAAAATACCATCTCCGTGGATCGGCCAGTGAAAAAGAAAAAAACCAAG
NM_000070.2       TCTGAGGAAGTTGAAAATACCATCTCCGTGGATCGGCCAGTGAAAAAGAAAAAAACCAAG
NM_024344.1       TCTGAGGAAGTTGAAAATACCATCTCCGTGGATCGGCCAGT------------------G
NM_173088.1       TCTGAGGAAGTTGAAAATACCATCTCCGTGGATCGGCCAGTGAAAAAGAAAAAAACCAAG
                  *****************************************                  *

HsCD00351574      CCCATCATCTTCGTTTCGGACAGAGCAAACAGCAACAAGGAGCTGGGTGTGGACCAGGAG
NM_000070.2       CCCATCATCTTCGTTTCGGACAGAGCAAACAGCAACAAGGAGCTGGGTGTGGACCAGGAG
NM_024344.1       CCCATCATCTTCGTTTCGGACAGAGCAAACAGCAACAAGGAGCTGGGTGTGGACCAGGAG
NM_173088.1       CCCATCATCTTCGTTTCGGACAGAGCAAACAGCAACAAGGAGCTGGGTGTGGACCAGGAG
                  ************************************************************

HsCD00351574      TCAGAGGAGGGCAAAGGCAAAACAAGCCCTGATAAGCAAAAGCAGTCCCCACAGCCACAG
NM_000070.2       TCAGAGGAGGGCAAAGGCAAAACAAGCCCTGATAAGCAAAAGCAGTCCCCACAGCCACAG
NM_024344.1       TCAGAGGAGGGCAAAGGCAAAACAAGCCCTGATAAGCAAAAGCAGTCCCCACAGCCACAG
NM_173088.1       TCAGAGGAGGGCAAAGGCAAAACAAGCCCTGATAAGCAAAAGCAGTCCCCACAGCCACAG
                  ************************************************************

HsCD00351574      CCTGGCAGCTCTGATCAGGAAAGTGAGGAACAGCAACAATTCCGGAACATTTTCAAGCAG
NM_000070.2       CCTGGCAGCTCTGATCAGGAAAGTGAGGAACAGCAACAATTCCGGAACATTTTCAAGCAG
NM_024344.1       CCTGGCAGCTCTGATCAGGAAAGTGAGGAACAGCAACAATTCCGGAACATTTTCAAGCAG
NM_173088.1       CCTGGCAGCTCTGATCAGGAAAGTGAGGAACAGCAACAATTCCGGAACATTTTCAAGCAG
                  ************************************************************

HsCD00351574      ATAGCAGGAGATGACATGGAGATCTGTGCAGATGAGCTCAAGAAGGTCCTTAACACAGTC
NM_000070.2       ATAGCAGGAGATGACATGGAGATCTGTGCAGATGAGCTCAAGAAGGTCCTTAACACAGTC
NM_024344.1       ATAGCAGGAGATGACATGGAGATCTGTGCAGATGAGCTCAAGAAGGTCCTTAACACAGTC
NM_173088.1       ATAGCAGGAGATGACATGGAGATCTGTGCAGATGAGCTCAAGAAGGTCCTTAACACAGTC
                  ************************************************************

HsCD00351574      GTGAACAAACACAAGGACCTGAAGACACACGGGTTCACACTGGAGTCCTGCCGTAGCATG
NM_000070.2       GTGAACAAACACAAGGACCTGAAGACACACGGGTTCACACTGGAGTCCTGCCGTAGCATG
NM_024344.1       GTGAACAAACACAAGGACCTGAAGACACACGGGTTCACACTGGAGTCCTGCCGTAGCATG
NM_173088.1       GTGAACAAACACAAGGACCTGAAGACACACGGGTTCACACTGGAGTCCTGCCGTAGCATG
                  ************************************************************

HsCD00351574      ATTGCGCTCATGGATACAGATGGCTCTGGAAAGCTCAACCTGCAGGAGTTCCACCACCTC
NM_000070.2       ATTGCGCTCATGGATACAGATGGCTCTGGAAAGCTCAACCTGCAGGAGTTCCACCACCTC
NM_024344.1       ATTGCGCTCATGGATACAGATGGCTCTGGAAAGCTCAACCTGCAGGAGTTCCACCACCTC
NM_173088.1       ATTGCGCTCATGGATACAGATGGCTCTGGAAAGCTCAACCTGCAGGAGTTCCACCACCTC
                  ************************************************************

HsCD00351574      TGGAACAAGATTAAGGCCTGGCAGAAAATTTTCAAACACTATGACACAGACCAGTCCGGC
NM_000070.2       TGGAACAAGATTAAGGCCTGGCAGAAAATTTTCAAACACTATGACACAGACCAGTCCGGC
NM_024344.1       TGGAACAAGATTAAGGCCTGGCAGAAAATTTTCAAACACTATGACACAGACCAGTCCGGC
NM_173088.1       TGGAACAAGATTAAGGCCTGGCAGAAAATTTTCAAACACTATGACACAGACCAGTCCGGC
                  ************************************************************

HsCD00351574      ACCATCAACAGCTACGAGATGCGAAATGCAGTCAACGACGCAGGATTCCACCTCAACAAC
NM_000070.2       ACCATCAACAGCTACGAGATGCGAAATGCAGTCAACGACGCAGGATTCCACCTCAACAAC
NM_024344.1       ACCATCAACAGCTACGAGATGCGAAATGCAGTCAACGACGCAGGATTCCACCTCAACAAC
NM_173088.1       ACCATCAACAGCTACGAGATGCGAAATGCAGTCAACGACGCAGGATTCCACCTCAACAAC
                  ************************************************************

HsCD00351574      CAGCTCTATGACATCATTACCATGCGGTACGCAGACAAACACATGAACATCGACTTTGAC
NM_000070.2       CAGCTCTATGACATCATTACCATGCGGTACGCAGACAAACACATGAACATCGACTTTGAC
NM_024344.1       CAGCTCTATGACATCATTACCATGCGGTACGCAGACAAACACATGAACATCGACTTTGAC
NM_173088.1       CAGCTCTATGACATCATTACCATGCGGTACGCAGACAAACACATGAACATCGACTTTGAC
                  ************************************************************

HsCD00351574      AGTTTCATCTGCTGCTTCGTTAGGCTGGAGGGCATGTTCAGAGCTTTTCATGCATTTGAC
NM_000070.2       AGTTTCATCTGCTGCTTCGTTAGGCTGGAGGGCATGTTCAGAGCTTTTCATGCATTTGAC
NM_024344.1       AGTTTCATCTGCTGCTTCGTTAGGCTGGAGGGCATGTTCAGAGCTTTTCATGCATTTGAC
NM_173088.1       AGTTTCATCTGCTGCTTCGTTAGGCTGGAGGGCATGTTCAGAGCTTTTCATGCATTTGAC
                  ************************************************************

HsCD00351574      AAGGATGGAGATGGTATCATCAAGCTCAACGTTCTGGAGTGGCTGCAGCTCACCATGTAT
NM_000070.2       AAGGATGGAGATGGTATCATCAAGCTCAACGTTCTGGAGTGGCTGCAGCTCACCATGTAT
NM_024344.1       AAGGATGGAGATGGTATCATCAAGCTCAACGTTCTGGAGTGGCTGCAGCTCACCATGTAT
NM_173088.1       AAGGATGGAGATGGTATCATCAAGCTCAACGTTCTGGAGTGGCTGCAGCTCACCATGTAT
                  ************************************************************

HsCD00351574      GCCTGA
NM_000070.2       GCCTGA
NM_024344.1       GCCTGA
NM_173088.1       GCCTGA
                  ******

Pathways

Panther : Huntington disease
WikiPathway : Integrin-mediated cell adhesion

Protein

SMART domain : calpain_III :
SMART domain : EFh : EF-hand, calcium binding motif
UniProt : P20807
UniProt : Q9BQC8
HPRD : 00255

Clone

Cloning Information : 564181

Organism


TAX_ID : 9606
Species Specific ID: 825

Genome

Chromosome : 15
Map Location : 15q15.1
Ensembl : ENSG00000092529

Reagents

Labome : CAPN3-antibody