DNASU Plasmid Repository • 480.965.5697 | Email

C1QA (Homo sapiens) in pENTR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  C1QA
Gene Name:  complement component 1, q subcomponent, A chain
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR221               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100068506)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00351742

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 735nts         Open reading frame : 1 to 735
Reference Sequence Alignment

ATGGAGGGTCCCCGGGGATGGCTGGTGCTCTGTGTGCTGGCCATATCGCTGGCCTCTATG
GTGACCGAGGACTTGTGCCGAGCACCAGACGGGAAGAAAGGGGAGGCAGGAAGACCTGGC
AGACGGGGGCGGCCAGGCCTCAAGGGGGAGCAAGGGGAGCCGGGGGCCCCTGGCATCCGG
ACAGGCATCCAAGGCCTTAAAGGAGACCAGGGGGAACCTGGGCCCTCTGGAAACCCCGGC
AAGGTGGGCTACCCAGGGCCCAGCGGCCCCCTCGGGGCCCGTGGCATCCCGGGAATTAAA
GGCACCAAGGGCAGCCCAGGAAACATCAAGGACCAGCCGAGGCCAGCCTTCTCCGCCATT
CGGCGGAACCCCCCAATGGGGGGCAACGTGGTCATCTTCGACACGGTCATCACCAACCAG
GAAGAACCGTACCAGAACCACTCCGGCCGATTCGTCTGCACTGTACCCGGCTACTACTAC
TTCACCTTCCAGGTGCTGTCCCAGTGGGAAATCTGCCTGTCCATCGTCTCCTCCTCAAGG
GGCCAGGTCCGACGCTCCCTGGGCTTCTGTGACACCACCAACAAGGGGCTCTTCCAGGTG
GTGTCAGGGGGCATGGTGCTTCAGCTGCAGCAGGGTGACCAGGTCTGGGTTGAAAAAGAC
CCCAAAAAGGGTCACATTTACCAGGGCTCTGAGGCCGACAGCGTCTTCAGCGGCTTCCTC
ATCTTCCCATCTGCC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR221

pENTR221 in advanced viewed

Synonyms: pDONR221, pENTR221-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; kanamycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php.
Size (bp): 2574
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 1905 4
primer site M13 F M13 forward priming site 846 865
primer site M13 Rev M13 reverse primer site 846 865
recombination site rrnBT2 rrnB T2 transcription termination sequence 275 302
recombination site rrnBT1 rrnB T1 transcription termination sequence 434 477
recombination site attL1 attL1 recombination site 575 675
recombination site attL2 attL2 recombination site 805 706
selectable marker KanR kanamycin resistance gene 975 1784

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : C1QA
Symbol Nomenclature : C1QA
Designation : complement C1q subcomponent subunit A|complement component 1, q subcomponent, alpha polypeptide|complement component C1q, A chain
Full Nomenclature : complement component 1, q subcomponent, A chain
GENEID : 712
GenBank Accession : 564349
HGNC : 1241
MIM : 120550
Vega : OTTHUMG00000002893
Target GenBank: GQ129447

 

Reference Sequence Alignment

  

HsCD00351742      ATGGAGGGTCCCCGGGGATGGCTGGTGCTCTGTGTGCTGGCCATATCGCTGGCCTCTATG
NM_015991.2       ATGGAGGGTCCCCGGGGATGGCTGGTGCTCTGTGTGCTGGCCATATCGCTGGCCTCTATG
                  ************************************************************

HsCD00351742      GTGACCGAGGACTTGTGCCGAGCACCAGACGGGAAGAAAGGGGAGGCAGGAAGACCTGGC
NM_015991.2       GTGACCGAGGACTTGTGCCGAGCACCAGACGGGAAGAAAGGGGAGGCAGGAAGACCTGGC
                  ************************************************************

HsCD00351742      AGACGGGGGCGGCCAGGCCTCAAGGGGGAGCAAGGGGAGCCGGGGGCCCCTGGCATCCGG
NM_015991.2       AGACGGGGGCGGCCAGGCCTCAAGGGGGAGCAAGGGGAGCCGGGGGCCCCTGGCATCCGG
                  ************************************************************

HsCD00351742      ACAGGCATCCAAGGCCTTAAAGGAGACCAGGGGGAACCTGGGCCCTCTGGAAACCCCGGC
NM_015991.2       ACAGGCATCCAAGGCCTTAAAGGAGACCAGGGGGAACCTGGGCCCTCTGGAAACCCCGGC
                  ************************************************************

HsCD00351742      AAGGTGGGCTACCCAGGGCCCAGCGGCCCCCTCGGGGCCCGTGGCATCCCGGGAATTAAA
NM_015991.2       AAGGTGGGCTACCCAGGGCCCAGCGGCCCCCTCGGAGCCCGTGGCATCCCGGGAATTAAA
                  ***********************************.************************

HsCD00351742      GGCACCAAGGGCAGCCCAGGAAACATCAAGGACCAGCCGAGGCCAGCCTTCTCCGCCATT
NM_015991.2       GGCACCAAGGGCAGCCCAGGAAACATCAAGGACCAGCCGAGGCCAGCCTTCTCCGCCATT
                  ************************************************************

HsCD00351742      CGGCGGAACCCCCCAATGGGGGGCAACGTGGTCATCTTCGACACGGTCATCACCAACCAG
NM_015991.2       CGGCGGAACCCCCCAATGGGGGGCAACGTGGTCATCTTCGACACGGTCATCACCAACCAG
                  ************************************************************

HsCD00351742      GAAGAACCGTACCAGAACCACTCCGGCCGATTCGTCTGCACTGTACCCGGCTACTACTAC
NM_015991.2       GAAGAACCGTACCAGAACCACTCCGGCCGATTCGTCTGCACTGTACCCGGCTACTACTAC
                  ************************************************************

HsCD00351742      TTCACCTTCCAGGTGCTGTCCCAGTGGGAAATCTGCCTGTCCATCGTCTCCTCCTCAAGG
NM_015991.2       TTCACCTTCCAGGTGCTGTCCCAGTGGGAAATCTGCCTGTCCATCGTCTCCTCCTCAAGG
                  ************************************************************

HsCD00351742      GGCCAGGTCCGACGCTCCCTGGGCTTCTGTGACACCACCAACAAGGGGCTCTTCCAGGTG
NM_015991.2       GGCCAGGTCCGACGCTCCCTGGGCTTCTGTGACACCACCAACAAGGGGCTCTTCCAGGTG
                  ************************************************************

HsCD00351742      GTGTCAGGGGGCATGGTGCTTCAGCTGCAGCAGGGTGACCAGGTCTGGGTTGAAAAAGAC
NM_015991.2       GTGTCAGGGGGCATGGTGCTTCAGCTGCAGCAGGGTGACCAGGTCTGGGTTGAAAAAGAC
                  ************************************************************

HsCD00351742      CCCAAAAAGGGTCACATTTACCAGGGCTCTGAGGCCGACAGCGTCTTCAGCGGCTTCCTC
NM_015991.2       CCCAAAAAGGGTCACATTTACCAGGGCTCTGAGGCCGACAGCGTCTTCAGCGGCTTCCTC
                  ************************************************************

HsCD00351742      ATCTTCCCATCTGCC---
NM_015991.2       ATCTTCCCATCTGCCTGA
                  ***************   

Pathways

Reactome : Classical antibody-mediated complement activation
Reactome : Complement cascade
Reactome : Creation of C4 and C2 activators
Reactome : Immune System
Reactome : Initial triggering of complement
Reactome : Innate Immune System
WikiPathway : Complement Activation, Classical Pathway
WikiPathway : Complement and Coagulation Cascades

Protein

SMART domain : C1Q : Complement component C1q domain.
UniProt : P02745
HPRD : 00393

Clone

Cloning Information : 564349

Organism


TAX_ID : 9606
Species Specific ID: 712

Genome

Chromosome : 1
Map Location : 1p36.12
Ensembl : ENSG00000173372

Reagents

Labome : C1QA-antibody