DNASU Plasmid Repository • 480.965.5697 | Email

POLR3H (Homo sapiens) in pENTR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  POLR3H
Gene Name:  polymerase (RNA) III (DNA directed) polypeptide H (22.9kD)
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR221               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100068667)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00351854

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 612nts         Open reading frame : 1 to 612
Reference Sequence Alignment

ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGG
AAGCTCAACGACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTAC
AACGTGGGACTCTGCATTTGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTC
CCTGGGGATGGCGCATCACACACCAAAGTCCATTTTCGCTGCGTGGTGTTTCATCCATTC
CTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGCAGCCCAGAAGGAGTGCACGTCTCT
CTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTC
GACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTC
TACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACG
TCCCCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAG
GAGGCTCCGTACACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGG
TGGACCAGCAAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR221

pENTR221 in advanced viewed

Synonyms: pDONR221, pENTR221-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; kanamycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php.
Size (bp): 2574
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC origin of replication 1905 4
primer site M13 F M13 forward priming site 846 865
primer site M13 Rev M13 reverse primer site 846 865
recombination site rrnBT2 rrnB T2 transcription termination sequence 275 302
recombination site rrnBT1 rrnB T1 transcription termination sequence 434 477
recombination site attL1 attL1 recombination site 575 675
recombination site attL2 attL2 recombination site 805 706
selectable marker KanR kanamycin resistance gene 975 1784

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : POLR3H
Symbol Nomenclature : POLR3H
SYNONYM : RPC22.9; RPC8
Designation : DNA-directed RNA polymerase III subunit 22.9 kDa polypeptide|DNA-directed RNA polymerase III subunit H|DNA-directed RNA polymerase III subunit RPC8|RNA nucleotidyltransferase (DNA-directed)|RNA polymerase III subunit C8
Full Nomenclature : polymerase (RNA) III (DNA directed) polypeptide H (22.9kD)
GENEID : 171568
Locus Tag : RP3-347H13.9
GenBank Accession : 564461
HGNC : 30349
Vega : OTTHUMG00000150971
Target GenBank: GQ129271

 

Reference Sequence Alignment

  

HsCD00351854        ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGG
NM_001282884.1      ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGG
NM_138338.4         ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGG
NM_001018050.3      ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGG
NM_001282885.1      ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGG
                    ************************************************************

HsCD00351854        AAGCTCAACGACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTAC
NM_001282884.1      AAGCTCAACGACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTAC
NM_138338.4         AAGCTCAACGACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTAC
NM_001018050.3      AAGCTCAACGACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTAC
NM_001282885.1      AAGCTCAACGACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTAC
                    ************************************************************

HsCD00351854        AACGTGGGACTCTGCATTTGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTC
NM_001282884.1      AACGTGGGACTCTGCATTTGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTC
NM_138338.4         AACGTGGGACTCTGCATTTGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTC
NM_001018050.3      AACGTGGGACTCTGCATTTGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTC
NM_001282885.1      AACGTGGGACTCTGCATTTGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTC
                    ************************************************************

HsCD00351854        CCTGGGGATGGCGCATCACACACCAAAGTCCATTTTCGCTGCGTGGTGTTTCATCCATTC
NM_001282884.1      CCTGGGGATGGCGCATCACACACCAAAGTCCATTTTCGCTGCGTGGTGTTTCATCCATTC
NM_138338.4         CCTGGGGATGGCGCATCACACACCAAAGTCCATTTTCGCTGCGTGGTGTTTCATCCATTC
NM_001018050.3      CCTGGGGATGGCGCATCACACACCAAAGTCCATTTTCGCTGCGTGGTGTTTCATCCATTC
NM_001282885.1      CCTGGGGATGGCGCATCACACACCAAAGTCCATTTTCGCTGCGTGGTGTTTCATCCATTC
                    ************************************************************

HsCD00351854        CTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGCAGCCCAGAAGGAGTGCACGTCTCT
NM_001282884.1      CTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGCAGCCCAGAAGGAGTGCACGTCTCT
NM_138338.4         CTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGCAGCCCAGAAGGAGTGCACGTCTCT
NM_001018050.3      CTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGCAGCCCAGAAGGAGTGCACGTCTCT
NM_001282885.1      CTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGCAGCCCAGAAGGAGTGCACGTCTCT
                    ************************************************************

HsCD00351854        CTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTC
NM_001282884.1      CTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTC
NM_138338.4         CTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTC
NM_001018050.3      CTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTC
NM_001282885.1      CTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTC
                    ************************************************************

HsCD00351854        GACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTC
NM_001282884.1      GACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTC
NM_138338.4         GACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTC
NM_001018050.3      GACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTC
NM_001282885.1      GACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTC
                    ************************************************************

HsCD00351854        TACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACG
NM_001282884.1      TACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACG
NM_138338.4         TACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACG
NM_001018050.3      TACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACG
NM_001282885.1      TACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACG
                    ************************************************************

HsCD00351854        TCCCCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAG
NM_001282884.1      TCCCCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAG
NM_138338.4         TCCCCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAG
NM_001018050.3      TCCCCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAG
NM_001282885.1      TCCCCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAG
                    ************************************************************

HsCD00351854        GAGGCTCCGTACACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGG
NM_001282884.1      GAGGCTCCGTACACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGG
NM_138338.4         GAGGCTCCGTACACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGG
NM_001018050.3      GAGGCTCCGTACACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGG
NM_001282885.1      GAGGCTCCGTACACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGG
                    ************************************************************

HsCD00351854        TGGACCAGCAAC---
NM_001282884.1      TGGACCAGCAACTAG
NM_138338.4         TGGACCAGCAACTAG
NM_001018050.3      TGGACCAGCAACTAG
NM_001282885.1      TGGACCAGCAACTAG
                    ************   

Pathways

Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Gene Expression
Reactome : Immune System
Reactome : Innate Immune System
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : RNA Polymerase III Abortive And Retractive Initiation
Reactome : RNA Polymerase III Chain Elongation
Reactome : RNA Polymerase III Transcription
Reactome : RNA Polymerase III Transcription Initiation
Reactome : RNA Polymerase III Transcription Initiation From Type 1 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 2 Promoter
Reactome : RNA Polymerase III Transcription Initiation From Type 3 Promoter
Reactome : RNA Polymerase III Transcription Termination
Reactome : Transcription
WikiPathway : Eukaryotic Transcription Initiation

Protein

UniProt : Q6ZPA8
UniProt : Q9Y535
HPRD : 15157

Clone

Cloning Information : 564461

Organism


TAX_ID : 9606
Species Specific ID: 171568

Genome

Chromosome : 22
Map Location : 22q13.2
Ensembl : ENSG00000100413

Reagents

Labome : POLR3H-antibody