DNASU Plasmid Repository • 480.965.5697 | Email

ACTL6B (Homo sapiens) in pDONR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ACTL6B
Gene Name:  actin-like 6B
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100071246)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00352610

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1278nts        
Open reading frame : 1 to 1278
Reference Sequence Alignment

ATGAGCGGGGGCGTCTACGGCGGAGATGAGGTGGGGGCGCTGGTCTTTGACATTGGCTCC
TTCTCAGTCCGCGCTGGGTACGCTGGGGAGGACTGTCCCAAGGCTGACTTCCCCACCACA
GTGGGGCTGCTGGCCGCGGAGGAGGGGGGCGGGCTGGAGCTGGAGGGGGACAAAGAGAAG
AAAGGGAAGATCTTCCACATCGACACCAATGCCCTGCACGTGCCTCGGGATGGAGCGGAG
GTCATGTCGCCCCTCAAGAATGGCATGATCGAGGACTGGGAGTGCTTCCGAGCCATCCTG
GATCACACCTACAGCAAACACGTCAAGTCTGAGCCAAACCTGCACCCAGTGCTCATGTCC
GAGGCTCCGTGGAACACACGGGCCAAGCGGGAGAAGCTGACAGAGCTGATGTTCGAGCAG
TACAACATTCCTGCCTTCTTCTTATGCAAGACGGCTGTGCTCACCGCCTTTGCAAACGGG
CGGTCCACTGGCCTCGTGCTGGACAGTGGAGCCACCCACACCACGGCCATTCCAGTACAT
GACGGCTACGTTCTGCAGCAAGGCATCGTCAAGTCCCCTCTGGCAGGGGACTTCATCTCC
ATGCAGTGCCGGGAGCTGTTCCAGGAGATGGCCATTGACATCATCCCACCTTACATGATC
GCAGCCAAGGAGCCTGTCCGGGAGGGTGCCCCCCCAAACTGGAAGAAGAAGGAGAAGCTA
CCCCAGGTCTCCAAGTCCTGGCATAACTACATGTGTAATGAGGTGATCCAGGACTTCCAG
GCCTCCGTGCTGCAGGTCTCAGACTCCCCCTACGATGAACAGGTGGCTGCACAAATGCCC
ACAGTGCACTACGAGATGCCCAATGGCTACAATACAGACTACGGCGCCGAGCGACTCCGC
ATCCCTGAGGGCCTGTTTGATCCCTCGAACGTCAAGGGCCTGTCGGGGAACACCATGTTG
GGTGTGGGCCACGTGGTGACCACCAGCATCGGCATGTGTGACATTGATATTCGCCCGGGC
CTGTACGGGAGTGTCATTGTCACCGGCGGGAACACACTGCTGCAGGGCTTCACTGACAGG
CTCAATCGAGAGCTTTCCCAGAAGACCCCACCGAGCATGCGACTGAAACTCATTGCCAGC
AACAGCACCATGGAGCGCAAGTTCAGCCCCTGGATCGGGGGTTCCATCCTGGCCTCACTG
GGCACTTTCCAGCAGATGTGGATCTCCAAGCAGGAATATGAGGAGGGCGGGAAGCAGTGC
GTGGAGCGAAAGTGCCCC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR223

pDONR223 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Recombinational donor/master vector; spectinomycin resistance; recombinational cloning.
Comments: pDONR223 contains several improvements over the original Donor vector pDONR201. In pDONR223, the universal Forward (Fwd) and Reverse (Rev) sequencing primer sites flank the attP1 and attP2 recombination sites, the replication origin has been improved to increase copy number, and the selectable marker is spectinomycin resistance (instead of kanamycin resistance in pDONR201), which permits the use of either ampicillin or kanamycin resistance markers in Destination vectors.
Size (bp): 5005
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 bacterial origin 4339 4958
death cassette ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1200 1409
primer M13 forward M13 forward sequencing primer 536 553
primer M13 reverse M13 reverse sequencing primer 3020 3040
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only 569 652
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only 2896 2983
selectable marker SpectR spectinomycin resistance gene 3471 4262
trxn termination sequence rrnB rrnB T1 and T2 terminator 268 470

 

  • Gene
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ACTL6B
Symbol Nomenclature : ACTL6B
SYNONYM : ACTL6; BAF53B
Designation : 53 kDa BRG1-associated factor B|BRG1-associated factor 53B|actin-like 6|actin-like protein 6B|actin-related protein Baf53b|arpNalpha|hArpN alpha
Full Nomenclature : actin-like 6B
GENEID : 51412
GenBank Accession : 565217
HGNC : 160
MIM : 612458
Vega : OTTHUMG00000159661
Target GenBank: HQ447891

 

Reference Sequence Alignment

  

HsCD00352610      ATGAGCGGGGGCGTCTACGGCGGAGATGAGGTGGGGGCGCTGGTCTTTGACATTGGCTCC
NM_016188.4       ATGAGCGGGGGCGTCTACGGCGGAGATGAGGTGGGGGCGCTGGTCTTTGACATTGGCTCC
                  ************************************************************

HsCD00352610      TTCTCAGTCCGCGCTGGGTACGCTGGGGAGGACTGTCCCAAGGCTGACTTCCCCACCACA
NM_016188.4       TTCTCAGTCCGCGCTGGGTACGCTGGGGAGGACTGTCCCAAGGCTGACTTCCCCACCACA
                  ************************************************************

HsCD00352610      GTGGGGCTGCTGGCCGCGGAGGAGGGGGGCGGGCTGGAGCTGGAGGGGGACAAAGAGAAG
NM_016188.4       GTGGGGCTGCTGGCCGCGGAGGAGGGGGGCGGGCTGGAGCTGGAGGGGGACAAAGAGAAG
                  ************************************************************

HsCD00352610      AAAGGGAAGATCTTCCACATCGACACCAATGCCCTGCACGTGCCTCGGGATGGAGCGGAG
NM_016188.4       AAAGGGAAGATCTTCCACATCGACACCAATGCCCTGCACGTGCCTCGGGATGGAGCGGAG
                  ************************************************************

HsCD00352610      GTCATGTCGCCCCTCAAGAATGGCATGATCGAGGACTGGGAGTGCTTCCGAGCCATCCTG
NM_016188.4       GTCATGTCGCCCCTCAAGAATGGCATGATCGAGGACTGGGAGTGCTTCCGAGCCATCCTG
                  ************************************************************

HsCD00352610      GATCACACCTACAGCAAACACGTCAAGTCTGAGCCAAACCTGCACCCAGTGCTCATGTCC
NM_016188.4       GATCACACCTACAGCAAACACGTCAAGTCTGAGCCAAACCTGCACCCAGTGCTCATGTCC
                  ************************************************************

HsCD00352610      GAGGCTCCGTGGAACACACGGGCCAAGCGGGAGAAGCTGACAGAGCTGATGTTCGAGCAG
NM_016188.4       GAGGCTCCGTGGAACACACGGGCCAAGCGGGAGAAGCTGACAGAGCTGATGTTCGAGCAG
                  ************************************************************

HsCD00352610      TACAACATTCCTGCCTTCTTCTTATGCAAGACGGCTGTGCTCACCGCCTTTGCAAACGGG
NM_016188.4       TACAACATTCCTGCCTTCTTCTTATGCAAGACGGCTGTGCTCACCGCCTTTGCAAACGGG
                  ************************************************************

HsCD00352610      CGGTCCACTGGCCTCGTGCTGGACAGTGGAGCCACCCACACCACGGCCATTCCAGTACAT
NM_016188.4       CGGTCCACTGGCCTCGTGCTGGACAGTGGAGCCACCCACACCACGGCCATTCCAGTACAT
                  ************************************************************

HsCD00352610      GACGGCTACGTTCTGCAGCAAGGCATCGTCAAGTCCCCTCTGGCAGGGGACTTCATCTCC
NM_016188.4       GACGGCTACGTTCTGCAGCAAGGCATCGTCAAGTCCCCTCTGGCAGGGGACTTCATCTCC
                  ************************************************************

HsCD00352610      ATGCAGTGCCGGGAGCTGTTCCAGGAGATGGCCATTGACATCATCCCACCTTACATGATC
NM_016188.4       ATGCAGTGCCGGGAGCTGTTCCAGGAGATGGCCATTGACATCATCCCACCTTACATGATC
                  ************************************************************

HsCD00352610      GCAGCCAAGGAGCCTGTCCGGGAGGGTGCCCCCCCAAACTGGAAGAAGAAGGAGAAGCTA
NM_016188.4       GCAGCCAAGGAGCCTGTCCGGGAGGGTGCCCCCCCAAACTGGAAGAAGAAGGAGAAGCTA
                  ************************************************************

HsCD00352610      CCCCAGGTCTCCAAGTCCTGGCATAACTACATGTGTAATGAGGTGATCCAGGACTTCCAG
NM_016188.4       CCCCAGGTCTCCAAGTCCTGGCATAACTACATGTGTAATGAGGTGATCCAGGACTTCCAG
                  ************************************************************

HsCD00352610      GCCTCCGTGCTGCAGGTCTCAGACTCCCCCTACGATGAACAGGTGGCTGCACAAATGCCC
NM_016188.4       GCCTCCGTGCTGCAGGTCTCAGACTCCCCCTACGATGAACAGGTGGCTGCACAAATGCCC
                  ************************************************************

HsCD00352610      ACAGTGCACTACGAGATGCCCAATGGCTACAATACAGACTACGGCGCCGAGCGACTCCGC
NM_016188.4       ACAGTGCACTACGAGATGCCCAATGGCTACAATACAGACTACGGCGCCGAGCGACTCCGC
                  ************************************************************

HsCD00352610      ATCCCTGAGGGCCTGTTTGATCCCTCGAACGTCAAGGGCCTGTCGGGGAACACCATGTTG
NM_016188.4       ATCCCTGAGGGCCTGTTTGATCCCTCGAACGTCAAGGGCCTGTCGGGGAACACCATGTTG
                  ************************************************************

HsCD00352610      GGTGTGGGCCACGTGGTGACCACCAGCATCGGCATGTGTGACATTGATATTCGCCCGGGC
NM_016188.4       GGTGTGGGCCACGTGGTGACCACCAGCATCGGCATGTGTGACATTGATATTCGCCCGGGC
                  ************************************************************

HsCD00352610      CTGTACGGGAGTGTCATTGTCACCGGCGGGAACACACTGCTGCAGGGCTTCACTGACAGG
NM_016188.4       CTGTACGGGAGTGTCATTGTCACCGGCGGGAACACACTGCTGCAGGGCTTCACTGACAGG
                  ************************************************************

HsCD00352610      CTCAATCGAGAGCTTTCCCAGAAGACCCCACCGAGCATGCGACTGAAACTCATTGCCAGC
NM_016188.4       CTCAATCGAGAGCTTTCCCAGAAGACCCCACCGAGCATGCGACTGAAACTCATTGCCAGC
                  ************************************************************

HsCD00352610      AACAGCACCATGGAGCGCAAGTTCAGCCCCTGGATCGGGGGTTCCATCCTGGCCTCACTG
NM_016188.4       AACAGCACCATGGAGCGCAAGTTCAGCCCCTGGATCGGGGGTTCCATCCTGGCCTCACTG
                  ************************************************************

HsCD00352610      GGCACTTTCCAGCAGATGTGGATCTCCAAGCAGGAATATGAGGAGGGCGGGAAGCAGTGC
NM_016188.4       GGCACTTTCCAGCAGATGTGGATCTCCAAGCAGGAATATGAGGAGGGCGGGAAGCAGTGC
                  ************************************************************

HsCD00352610      GTGGAGCGAAAGTGCCCC---
NM_016188.4       GTGGAGCGAAAGTGCCCCTGA
                  ******************   

Protein

SMART domain : ACTIN : Actin
UniProt : O94805
HPRD : 12419

Clone

Cloning Information : 565217

Organism


TAX_ID : 9606
Species Specific ID: 51412

Genome

Chromosome : 7
Map Location : 7q22
Ensembl : ENSG00000077080

Reagents

Labome : ACTL6B-antibody